Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC22A18 cdna clone

SLC22A18 cDNA Clone

Gene Names
SLC22A18; HET; ITM; BWR1A; IMPT1; TSSC5; ORCTL2; BWSCR1A; SLC22A1L; p45-BWR1A
Synonyms
SLC22A18; SLC22A18 cDNA Clone; SLC22A18 cdna clone
Ordering
For Research Use Only!
Sequence
atgcagggagctcgggctcccagggaccagggccagtcccccggcaggatgagcgctctaggccggtcctcggtcatcttgcttacctacgtgctggccgccacagaacttacctgcctcttcatgcagttctccatcgtgccatacctgtctcggaaactgggcctggattccattgccttcggctacctgcaaaccaccttcggggtgctgcagctgctgggcgggccggtgtttggcaggttcgcagaccagcgcggggcgcgggcggcgctcacgctctccttcctggctgccttggcgctctacctgctcctggcggccgcctccagcccggccctgcccggggtctacctgctcttcgcctcgcgcctgcccggagcgctcatgcacacgctgccagccgcccagatggtcatcacggacctgtcggcacccgaggagcggcccgcggccctgggccggctgggcctctgcttcggcgtcggagtcatcctcggctccctgctgggcgggaccctggtctccgcgtacgggattcagtgcccggccatcctggctgccctggccaccctcctgggagctgtcctcagcttcacctgcatccccgccagcaccaaaggggccaaaactgacgcccaggctccactgccaggcggcccccgggccagtgtgttcgacctgaaggccatcgcctccctgctgcggctgccagacgtcccgaggatcttcctggtgaaggtggcctccaactgccccacagggctcttcatggtcatgttctccatcatctccatggacttcttccagctggaggccgcccaagctggctacctcatgtccttcttcgggctcctccagatggtgacccagggcctggtcatcgggcagctgagcagccacttctcggaggaggtgctgctccgggccagcgtgctggtcttcatcgtggtgggcctggccatggcctggatgtccagcgtcttccacttctgcctcctggtgcccggcctggtgttcagcctctgcaccctcaacgtggtcaccgacagcatgctgatcaaggctgtctccacctcggacacagggaccatgctgggcctctgcgcctctgtacaaccactgctccgaactctgggacccacggtcggcggcctcctgtaccgcagctttggcgtccccgtcttcggccacgtgcaggttgctatcaatacccttgtcctcctggtcctctggaggaaacctatgccccagaggaaggacaaagtccggtga
Sequence Length
1275
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
44,846 Da
NCBI Official Full Name
Homo sapiens solute carrier family 22, member 18, mRNA
NCBI Official Synonym Full Names
solute carrier family 22 member 18
NCBI Official Symbol
SLC22A18
NCBI Official Synonym Symbols
HET; ITM; BWR1A; IMPT1; TSSC5; ORCTL2; BWSCR1A; SLC22A1L; p45-BWR1A
NCBI Protein Information
solute carrier family 22 member 18
UniProt Protein Name
Solute carrier family 22 member 18
Protein Family
UniProt Gene Name
SLC22A18
UniProt Synonym Gene Names
BWR1A; BWSCR1A; HET; IMPT1; ITM; ORCTL2; SLC22A1L; TSSC5; ORCTL-2; p45-BWR1A
UniProt Entry Name
S22AI_HUMAN

NCBI Description

This gene is one of several tumor-suppressing subtransferable fragments located in the imprinted gene domain of 11p15.5, an important tumor-suppressor gene region. Alterations in this region have been associated with the Beckwith-Wiedemann syndrome, Wilms tumor, rhabdomyosarcoma, adrenocortical carcinoma, and lung, ovarian, and breast cancer. This gene is imprinted, with preferential expression from the maternal allele. Mutations in this gene have been found in Wilms' tumor and lung cancer. This protein may act as a transporter of organic cations, and have a role in the transport of chloroquine and quinidine-related compounds in kidney. Several alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Oct 2015]

Uniprot Description

SLC22A18: May act as a transporter of organic cations based on a proton efflux antiport mechanism. May play a role in the transport of chloroquine and quinidine-related compounds in kidney. Defects in SLC22A18 are associated with lung cancer (LNCR). LNCR is a common malignancy affecting tissues of the lung. The most common form of lung cancer is non-small cell lung cancer (NSCLC) that can be divided into 3 major histologic subtypes: squamous cell carcinoma, adenocarcinoma, and large cell lung cancer. NSCLC is often diagnosed at an advanced stage and has a poor prognosis. Defects in SLC22A18 are a cause of rhabdomyosarcoma type 1 (RMS1). It is a form of rhabdomyosarcoma, a highly malignant tumor of striated muscle derived from primitive mesenchimal cells and exhibiting differentiation along rhabdomyoblastic lines. Rhabdomyosarcoma is one of the most frequently occurring soft tissue sarcomas and the most common in children. It occurs in four forms: alveolar, pleomorphic, embryonal and botryoidal rhabdomyosarcomas. Belongs to the major facilitator (TC 2.A.1) superfamily. Organic cation transporter (TC 2.A.1.19) family.

Protein type: Transporter, SLC family; Membrane protein, integral; Transporter; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 11p15.5

Cellular Component: apical plasma membrane; cytoplasm; membrane; nuclear envelope; plasma membrane

Molecular Function: drug transporter activity; drug:hydrogen antiporter activity; ubiquitin protein ligase binding

Biological Process: drug transport

Disease: Breast Cancer; Lung Cancer; Rhabdomyosarcoma, Embryonal, 1

Research Articles on SLC22A18

Similar Products

Product Notes

The SLC22A18 slc22a18 (Catalog #AAA1269664) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcagggag ctcgggctcc cagggaccag ggccagtccc ccggcaggat gagcgctcta ggccggtcct cggtcatctt gcttacctac gtgctggccg ccacagaact tacctgcctc ttcatgcagt tctccatcgt gccatacctg tctcggaaac tgggcctgga ttccattgcc ttcggctacc tgcaaaccac cttcggggtg ctgcagctgc tgggcgggcc ggtgtttggc aggttcgcag accagcgcgg ggcgcgggcg gcgctcacgc tctccttcct ggctgccttg gcgctctacc tgctcctggc ggccgcctcc agcccggccc tgcccggggt ctacctgctc ttcgcctcgc gcctgcccgg agcgctcatg cacacgctgc cagccgccca gatggtcatc acggacctgt cggcacccga ggagcggccc gcggccctgg gccggctggg cctctgcttc ggcgtcggag tcatcctcgg ctccctgctg ggcgggaccc tggtctccgc gtacgggatt cagtgcccgg ccatcctggc tgccctggcc accctcctgg gagctgtcct cagcttcacc tgcatccccg ccagcaccaa aggggccaaa actgacgccc aggctccact gccaggcggc ccccgggcca gtgtgttcga cctgaaggcc atcgcctccc tgctgcggct gccagacgtc ccgaggatct tcctggtgaa ggtggcctcc aactgcccca cagggctctt catggtcatg ttctccatca tctccatgga cttcttccag ctggaggccg cccaagctgg ctacctcatg tccttcttcg ggctcctcca gatggtgacc cagggcctgg tcatcgggca gctgagcagc cacttctcgg aggaggtgct gctccgggcc agcgtgctgg tcttcatcgt ggtgggcctg gccatggcct ggatgtccag cgtcttccac ttctgcctcc tggtgcccgg cctggtgttc agcctctgca ccctcaacgt ggtcaccgac agcatgctga tcaaggctgt ctccacctcg gacacaggga ccatgctggg cctctgcgcc tctgtacaac cactgctccg aactctggga cccacggtcg gcggcctcct gtaccgcagc tttggcgtcc ccgtcttcgg ccacgtgcag gttgctatca atacccttgt cctcctggtc ctctggagga aacctatgcc ccagaggaag gacaaagtcc ggtga. It is sometimes possible for the material contained within the vial of "SLC22A18, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.