Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC22A14 cdna clone

SLC22A14 cDNA Clone

Gene Names
SLC22A14; OCTL2; OCTL4; ORCTL4
Synonyms
SLC22A14; SLC22A14 cDNA Clone; SLC22A14 cdna clone
Ordering
For Research Use Only!
Sequence
atggcaggagaggagaacttcaaggaagagctcagatcccaggatgcttccaggaacttgaaccagcatgaggtagcaggacatccacattcctggtctctggagatgctgttacgcagattgagggctgtccacaccaagcaggatgacaagtttgccaacctcctggatgcggtgggggagtttggcacattccagcagaggctagtagccctcacctttatccccagcatcatgtcggccttcttcatgtttgctgaccacttcgtgttcacagcccagaagccctattgcaataccagctggatcctggcagtgggcccccacctgtccaaagctgagcagctgaatctgaccataccccaagcacccaatggcagtttcctgacatgcttcatgtaccttcctgtgccttggaatctggattctatcatccagtttggcctcaatgacacagacacatgccaagatgggtggatctatcctgacgctaagaagcgatcgctgatcaatgagtttgacttggtatgtggcatggagacgaagaaggacactgcacagatcatgttcatggcagggctcccgataggctctctcatcttcaggctcataactgacaagatgggccgctaccctgccatcctgctgtcactgctggggctgatcatcttcggctttgggacagccttcatgaacagctttcacctgtatttgttctttcgctttggcatctcgcagtcagtggtgggctacgccatcagcagcatttctttggccactgagtggttagtgggtgagcaccgggcccacgccattatcctgggacactgctttttcgctgttggggccatgttgctgacagggatcgcctacggtcttccccactggcagctgctgtttctggtgggtgggatacttgtgatccccttcatctcctatatctggattctcccggagtccccgcggtggctgatgatgaaagggaaggtgaaggaggccaagcaggtgctgtgctacgccgcaagtgtgaacaagaagaccattccttcaaatctgctggacgagctgcagctgcccagaaagaaggtgactcgggcctctgtcctggacttctgtaagaataggcagctctgcaaggtgaccttggtgatgagctgtgtgtggtttaccgtcagttacacctattttacgttgagcctgagaatgagagagctgggcgtgagcgtccacttcagacacgtggtccccagcatcatggaggtgcctgcccggctgtgctgcatctttctcctccagcagattgggaggaagtggagcctggctgtgactctcctccaagccatcatctggtgcttgcttctccttttcctccctgaaggggaggatggcctcagactcaagtggccacgttgtccggccacagagctgaaatccatgacgatcttggtgctcatgctcagagagttcagcctggccgccactgtcactgtgttcttcctctacaccgctgagctcctccccactgtgctcagggcgacaggtctggggctggtgtctctggcctcggtggctggagccatcttgtccctgacaatcatcagccagaccccctccctcctgcccatctttctctgctgcgtcttagccatcgtggccttttccctctcctccctgctgccggaaacgcgagatcagcccctctccgagagcctgaaccactcctcacagataaggaataaggtcaaggacatgaagactaaggaaacatcatctgatgatgtctga
Sequence Length
1785
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
66,684 Da
NCBI Official Full Name
Homo sapiens solute carrier family 22, member 14, mRNA
NCBI Official Synonym Full Names
solute carrier family 22 member 14
NCBI Official Symbol
SLC22A14
NCBI Official Synonym Symbols
OCTL2; OCTL4; ORCTL4
NCBI Protein Information
solute carrier family 22 member 14
UniProt Protein Name
Solute carrier family 22 member 14
Protein Family
UniProt Gene Name
SLC22A14
UniProt Synonym Gene Names
OCTL2; ORCTL4; ORCTL-4
UniProt Entry Name
S22AE_HUMAN

NCBI Description

This gene encodes a member of the organic-cation transporter family. It is located in a gene cluster with another member of the family, organic cation transporter like 3. The encoded protein is a transmembrane protein which is thought to transport small molecules and since this protein is conserved among several species, it is suggested to have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]

Uniprot Description

SLC22A14: a member of the organic-cation transporter family. It is located in a gene cluster with another member of the family, organic cation transporter like 3. The encoded protein is a transmembrane protein which is thought to transport small molecules and since this protein is conserved among several species, it is suggested to have a fundamental role in mammalian systems. [provided by RefSeq, Jul 2008]

Protein type: Transporter; Membrane protein, integral; Transporter, SLC family; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 3p21.3

Cellular Component: integral to plasma membrane

Molecular Function: substrate-specific transmembrane transporter activity

Research Articles on SLC22A14

Similar Products

Product Notes

The SLC22A14 slc22a14 (Catalog #AAA1276326) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaggag aggagaactt caaggaagag ctcagatccc aggatgcttc caggaacttg aaccagcatg aggtagcagg acatccacat tcctggtctc tggagatgct gttacgcaga ttgagggctg tccacaccaa gcaggatgac aagtttgcca acctcctgga tgcggtgggg gagtttggca cattccagca gaggctagta gccctcacct ttatccccag catcatgtcg gccttcttca tgtttgctga ccacttcgtg ttcacagccc agaagcccta ttgcaatacc agctggatcc tggcagtggg cccccacctg tccaaagctg agcagctgaa tctgaccata ccccaagcac ccaatggcag tttcctgaca tgcttcatgt accttcctgt gccttggaat ctggattcta tcatccagtt tggcctcaat gacacagaca catgccaaga tgggtggatc tatcctgacg ctaagaagcg atcgctgatc aatgagtttg acttggtatg tggcatggag acgaagaagg acactgcaca gatcatgttc atggcagggc tcccgatagg ctctctcatc ttcaggctca taactgacaa gatgggccgc taccctgcca tcctgctgtc actgctgggg ctgatcatct tcggctttgg gacagccttc atgaacagct ttcacctgta tttgttcttt cgctttggca tctcgcagtc agtggtgggc tacgccatca gcagcatttc tttggccact gagtggttag tgggtgagca ccgggcccac gccattatcc tgggacactg ctttttcgct gttggggcca tgttgctgac agggatcgcc tacggtcttc cccactggca gctgctgttt ctggtgggtg ggatacttgt gatccccttc atctcctata tctggattct cccggagtcc ccgcggtggc tgatgatgaa agggaaggtg aaggaggcca agcaggtgct gtgctacgcc gcaagtgtga acaagaagac cattccttca aatctgctgg acgagctgca gctgcccaga aagaaggtga ctcgggcctc tgtcctggac ttctgtaaga ataggcagct ctgcaaggtg accttggtga tgagctgtgt gtggtttacc gtcagttaca cctattttac gttgagcctg agaatgagag agctgggcgt gagcgtccac ttcagacacg tggtccccag catcatggag gtgcctgccc ggctgtgctg catctttctc ctccagcaga ttgggaggaa gtggagcctg gctgtgactc tcctccaagc catcatctgg tgcttgcttc tccttttcct ccctgaaggg gaggatggcc tcagactcaa gtggccacgt tgtccggcca cagagctgaa atccatgacg atcttggtgc tcatgctcag agagttcagc ctggccgcca ctgtcactgt gttcttcctc tacaccgctg agctcctccc cactgtgctc agggcgacag gtctggggct ggtgtctctg gcctcggtgg ctggagccat cttgtccctg acaatcatca gccagacccc ctccctcctg cccatctttc tctgctgcgt cttagccatc gtggcctttt ccctctcctc cctgctgccg gaaacgcgag atcagcccct ctccgagagc ctgaaccact cctcacagat aaggaataag gtcaaggaca tgaagactaa ggaaacatca tctgatgatg tctga. It is sometimes possible for the material contained within the vial of "SLC22A14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.