Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC17A5 cdna clone

SLC17A5 cDNA Clone

Gene Names
SLC17A5; SD; AST; NSD; SLD; ISSD; SIASD; SIALIN
Synonyms
SLC17A5; SLC17A5 cDNA Clone; SLC17A5 cdna clone
Ordering
For Research Use Only!
Sequence
atgaggtctccggttcgagacctggcccggaacgatggcgaggagagcacggaccgcacgcctcttctaccgggcgccccacgggccgaagccgctccagtgtgctgctctgctcgttacaacttagcaattttggccttttttggtttcttcattgtgtatgcattacgtgtgaatctgagtgttgcgttagtggatatggtagattcaaatacaactttagaagataatagaacttccaaggcatgtccagagcattctgctcccataaaagttcatcataatcaaacgggtaagaagtaccaatgggatgcagaaactcaaggatggattctcggttcctttttttatggctacatcatcacacagattcctggaggatatgttgccagcaaaataggggggaaaatgctgctaggatttgggatccttggcactgctgtcctcaccctgttcactcccattgctgcagatttaggagttggaccactcattgtactcagagcactagaaggactaggagagggtgttacatttccagccatgcatgccatgtggtcttcttgggctccccctcttgaaagaagcaaacttcttagcatttcatatgcaggagcacagcttgggacagtaatttctcttcctctttctggaataatttgctactatatgaattggacttatgtcttctacttttttggtactattggaatattttggtttcttttgtggatctggttagttagtgacacaccacaaaaacacaagagaatttcccattatgaaaaggaatacattctttcatcattaagaaatcagctttcttcacagaagtcagtgccgtgggtacccattttaaaatccctgccactttgggctatcgtagttgcacacttttcttacaactggactttttatactttattgacattattgcctacttatatgaaggagatcctaaggttcaatgttcaagagaatgggtttttatcttcattgccttatttaggctcttggttatgtatgatcctgtctggtcaagctgctgacaatttaagggcaaaatggaatttttcaactttatgtgttcgcagaatttttagccttataggaatgattggacctgcagtattcctggtagctgctggcttcattggctgtgattattctttggccgttgctttcctaactatatcaacaacactgggaggcttttgctcttctggatttagcatcaaccatctggatattgctccttcgtatgctggtatcctcctgggcatcacaaatacatttgccactattccaggaatggttgggcccgtcattgctaaaagtctgacccctgataacactgttggagaatggcaaaccgtgttctatattgctgctgctattaatgtttttggtgccattttctttacactattcgccaaaggtgaagtacaaaactgggctctcaatgatcaccatggacacagacactga
Sequence Length
1488
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,667 Da
NCBI Official Full Name
Homo sapiens solute carrier family 17 (anion/sugar transporter), member 5, mRNA
NCBI Official Synonym Full Names
solute carrier family 17 member 5
NCBI Official Symbol
SLC17A5
NCBI Official Synonym Symbols
SD; AST; NSD; SLD; ISSD; SIASD; SIALIN
NCBI Protein Information
sialin
UniProt Protein Name
Sialin
Protein Family
UniProt Gene Name
SLC17A5
UniProt Synonym Gene Names
AST
UniProt Entry Name
S17A5_HUMAN

NCBI Description

This gene encodes a membrane transporter that exports free sialic acids that have been cleaved off of cell surface lipids and proteins from lysosomes. Mutations in this gene cause sialic acid storage diseases, including infantile sialic acid storage disorder and and Salla disease, an adult form. [provided by RefSeq, Jul 2008]

Uniprot Description

SLC17A5: Primary solute translocator for anionic substances; particularly it is a free sialic acid transporter in the lysosomes (Probable). Defects in SLC17A5 are the cause of Salla disease (SD); also known as Finnish type sialuria. SD is a sialic acid storage disease (SASD). SASDs are autosomal recessive neurodegenerative disorders characterized by hypotonia, cerebellar ataxia and mental retardation. They are caused by a defect in the metabolism of sialic acid which results in increased urinary excretion of unconjugated sialic acid, specifically N- acetylneuraminic acid. Enlarged lysosomes are seen on electron microscopic studies. Clinical symptoms of SD present usually at age less than 1 year and progression is slow. Defects in SLC17A5 are the cause of infantile sialic acid storage disorder (ISSD); also known as N- acetylneuraminic acid storage disease (NSD). ISSD is a severe form of sialic acid storage disease. Affected newborns exhibit visceromegaly, coarse features and failure to thrive immediately after birth. These patients have a shortened life span, usually less than 2 years. Infantile sialic acid storage disorder is associated with non-immune hydrops fetalis, a generalized edema of the fetus with fluid accumulation in the body cavities due to non-immune causes. Non-immune hydrops fetalis is not a diagnosis in itself but a symptom, a feature of many genetic disorders, and the end- stage of a wide variety of disorders. Belongs to the major facilitator superfamily. Sodium/anion cotransporter family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Vesicle; Transporter, SLC family; Transporter; Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 6q13

Cellular Component: cytoplasm; integral to plasma membrane; lysosomal membrane; membrane; plasma membrane

Molecular Function: sialic acid transmembrane transporter activity; sialic acid:hydrogen ion symporter activity; sugar:hydrogen ion symporter activity

Biological Process: anion transport; ion transport; sialic acid transport

Disease: Infantile Sialic Acid Storage Disease; Salla Disease

Research Articles on SLC17A5

Similar Products

Product Notes

The SLC17A5 slc17a5 (Catalog #AAA1267885) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaggtctc cggttcgaga cctggcccgg aacgatggcg aggagagcac ggaccgcacg cctcttctac cgggcgcccc acgggccgaa gccgctccag tgtgctgctc tgctcgttac aacttagcaa ttttggcctt ttttggtttc ttcattgtgt atgcattacg tgtgaatctg agtgttgcgt tagtggatat ggtagattca aatacaactt tagaagataa tagaacttcc aaggcatgtc cagagcattc tgctcccata aaagttcatc ataatcaaac gggtaagaag taccaatggg atgcagaaac tcaaggatgg attctcggtt ccttttttta tggctacatc atcacacaga ttcctggagg atatgttgcc agcaaaatag gggggaaaat gctgctagga tttgggatcc ttggcactgc tgtcctcacc ctgttcactc ccattgctgc agatttagga gttggaccac tcattgtact cagagcacta gaaggactag gagagggtgt tacatttcca gccatgcatg ccatgtggtc ttcttgggct ccccctcttg aaagaagcaa acttcttagc atttcatatg caggagcaca gcttgggaca gtaatttctc ttcctctttc tggaataatt tgctactata tgaattggac ttatgtcttc tacttttttg gtactattgg aatattttgg tttcttttgt ggatctggtt agttagtgac acaccacaaa aacacaagag aatttcccat tatgaaaagg aatacattct ttcatcatta agaaatcagc tttcttcaca gaagtcagtg ccgtgggtac ccattttaaa atccctgcca ctttgggcta tcgtagttgc acacttttct tacaactgga ctttttatac tttattgaca ttattgccta cttatatgaa ggagatccta aggttcaatg ttcaagagaa tgggttttta tcttcattgc cttatttagg ctcttggtta tgtatgatcc tgtctggtca agctgctgac aatttaaggg caaaatggaa tttttcaact ttatgtgttc gcagaatttt tagccttata ggaatgattg gacctgcagt attcctggta gctgctggct tcattggctg tgattattct ttggccgttg ctttcctaac tatatcaaca acactgggag gcttttgctc ttctggattt agcatcaacc atctggatat tgctccttcg tatgctggta tcctcctggg catcacaaat acatttgcca ctattccagg aatggttggg cccgtcattg ctaaaagtct gacccctgat aacactgttg gagaatggca aaccgtgttc tatattgctg ctgctattaa tgtttttggt gccattttct ttacactatt cgccaaaggt gaagtacaaa actgggctct caatgatcac catggacaca gacactga. It is sometimes possible for the material contained within the vial of "SLC17A5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.