Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SIX2 cdna clone

SIX2 cDNA Clone

Synonyms
SIX2; SIX2 cDNA Clone; SIX2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccatgctgcccaccttcggcttcacgcaggagcaagtggcgtgcgtgtgcgaggtgctgcagcagggcggcaacatcgagcggctgggccgcttcctgtggtcgctgcccgcctgcgagcaccttcacaagaatgaaagcgtgctcaaggccaaggccgtggtggccttccaccgcggcaacttccgcgagctctacaagatcctggagagccaccagttctcgccgcacaaccacgccaagctgcagcagctgtggctcaaggcacactacatcgaggcggagaagctgcgcggccgacccctgggcgccgtgggcaaataccgcgtgcgccgcaaattcccgctgccgcgctccatctgggacggcgaggagaccagctactgcttcaaggaaaagagtcgcagcgtgctgcgcgagtggtacgcgcacaacccctacccttcaccccgcgagaagcgtgagctgacggaggccacgggcctcaccaccacacaggtcagcaactggttcaagaaccggcggcagcgcgaccgggcggccgaggccaaggaaagggagaacaacgagaactccaattctaacagccacaacccgctgaatggcagcggcaagtcggtgttaggcagctcggaggatgagaagactccatcggggacgccagaccactcatcatccagccccgcactgctcctcagcccgccgccccctgggctgccgtccctgcacagcctgggccaccctccgggccccagcgcagtgccagtgccggtgccaggcggaggtggagcggacccactgcaacaccaccatggcctgcaggactccatcctcaaccccatgtcagccaacctcgtggacctgggctcctag
Sequence Length
876
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,286 Da
NCBI Official Full Name
Homo sapiens SIX homeobox 2, mRNA
NCBI Official Synonym Full Names
SIX homeobox 2
NCBI Official Symbol
SIX2
NCBI Protein Information
homeobox protein SIX2
UniProt Protein Name
Homeobox protein SIX2
Protein Family
UniProt Gene Name
SIX2
UniProt Entry Name
SIX2_HUMAN

NCBI Description

This gene is a member of the vertebrate gene family which encode proteins homologous to the Drosophila 'sine oculis' homeobox protein. The encoded protein is a transcription factor which, like other members of this gene family, may be involved in limb or eye development. [provided by RefSeq, Dec 2008]

Uniprot Description

SIX2: Transcription factor that plays an important role in the development of several organs, including kidney, skull and stomach. During kidney development, maintains cap mesenchyme multipotent nephron progenitor cells in an undifferentiated state by opposing the inductive signals emanating from the ureteric bud and cooperates with WNT9B to promote renewing progenitor cells proliferation. Acts through its interaction with TCF7L2 and OSR1 in a canonical Wnt signaling independent manner preventing transcription of differentiation genes in cap mesenchyme such as WNT4. Also acts independently of OSR1 to activate expression of many cap mesenchyme genes, including itself, GDNF and OSR1. During craniofacial development plays a role in growth and elongation of the cranial base through regulation of chondrocyte differentiation. During stomach organogenesis, controls pyloric sphincter formation and mucosal growth through regulation of a gene network including NKX2-5, BMPR1B, BMP4, SOX9 and GREM1. During branchial arch development, acts to mediate HOXA2 control over the insulin-like growth factor pathway. Also may be involved in limb tendon and ligament development. Plays a role in cell proliferation and migration. {ECO:0000250|UniProtKB:Q62232, ECO:0000269|PubMed:22995329}. Belongs to the SIX/Sine oculis homeobox family. {ECO:0000305}. Interacts with TCF7L2; in a canonical Wnt signaling independent manner; prevents transcription of differentiation genes in cap mesenchyme. Interacts with OSR1; form a strong repressor complex with TCF7L2, TLE2 and TLE3 to prevent the activation of Wnt/beta-catenin target genes in the cap mesenchyme. Interacts with HOXA11, EYA1 and EYA3. {ECO:0000250|UniProtKB:Q62232}

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: 2p21

Cellular Component: cytoplasm; nuclear membrane; nucleoplasm; nucleus; plasma membrane

Biological Process: anatomical structure morphogenesis; anterior/posterior axis specification; cell migration; cell proliferation; embryonic digestive tract morphogenesis; kidney development; mesodermal cell fate specification

Research Articles on SIX2

Similar Products

Product Notes

The SIX2 six2 (Catalog #AAA1271213) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccatgc tgcccacctt cggcttcacg caggagcaag tggcgtgcgt gtgcgaggtg ctgcagcagg gcggcaacat cgagcggctg ggccgcttcc tgtggtcgct gcccgcctgc gagcaccttc acaagaatga aagcgtgctc aaggccaagg ccgtggtggc cttccaccgc ggcaacttcc gcgagctcta caagatcctg gagagccacc agttctcgcc gcacaaccac gccaagctgc agcagctgtg gctcaaggca cactacatcg aggcggagaa gctgcgcggc cgacccctgg gcgccgtggg caaataccgc gtgcgccgca aattcccgct gccgcgctcc atctgggacg gcgaggagac cagctactgc ttcaaggaaa agagtcgcag cgtgctgcgc gagtggtacg cgcacaaccc ctacccttca ccccgcgaga agcgtgagct gacggaggcc acgggcctca ccaccacaca ggtcagcaac tggttcaaga accggcggca gcgcgaccgg gcggccgagg ccaaggaaag ggagaacaac gagaactcca attctaacag ccacaacccg ctgaatggca gcggcaagtc ggtgttaggc agctcggagg atgagaagac tccatcgggg acgccagacc actcatcatc cagccccgca ctgctcctca gcccgccgcc ccctgggctg ccgtccctgc acagcctggg ccaccctccg ggccccagcg cagtgccagt gccggtgcca ggcggaggtg gagcggaccc actgcaacac caccatggcc tgcaggactc catcctcaac cccatgtcag ccaacctcgt ggacctgggc tcctag. It is sometimes possible for the material contained within the vial of "SIX2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.