Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SIRT7 cdna clone

SIRT7 cDNA Clone

Gene Names
SIRT7; SIR2L7
Synonyms
SIRT7; SIRT7 cDNA Clone; SIRT7 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagccgggggtctgagccgctccgagcgcaaagcggcggagcgggtccggaggttgcgggaggagcagcagagggagcgcctccgccaggtgtcgcgcatcctgaggaaggcggcggcggagcgcagcgccgaggagggccggctgctggccgagagcgcggacctggtaacggagctgcagggccggagccggcggcgcgagggcctgaagcggcggcaggaggaggtgtgcgacgacccggaggagctgcgggggaaggtccgggagctggccagcgccgtccggaacgccaaatacttggtcgtctacacaggcgcgggaatcagcacggcagcgtctatcccagactaccggggccctaatggagtgtggacactgcttcagaaagggagaagcgttagtgctgccgacctgagcgaggccgagccaaccctcacccacatgagcatcacccgtctgcatgagcagaagctggtgcagcatgtggtgtctcagaactgtgacgggctccacctgaggagtgggctgccgcgcacggccatctccgagctccacgggaacatgtacattgaagtctgtacctcctgcgttcccaacagggagtacgtgcgggtgttcgatgtgacggagcgcactgccctccacagacaccagacaggccggacctgccacaagtgtgggacccagctgcgggacaccattgtgcactttggggagagggggacgttggggcagcctctgaactgggaagcggcgaccgaggctgccagcagagcagacaccatcctgtgtctagggtccagcctgaaggttctaaagaagtacccacgcctctggtgcatgaccaagccccctagccggcggccgaagctttacatcgtgaacctgcagtggaccccgaaggatgactgggctgccctgaagctacatgggaagtgtgatgacgtcatgcggctcctcatggccgagctgggcttggagatccccgcctatagcaggtggcaggatcccattttctcactggcgactcccctgcgtgctggtgaagaaggcagccacagtcggaagtcgctgtgcagaagcagagaggaggccccgcctggggaccggggtgcaccgcttagctcggcccccatcctagggggctggtttggcaggggctgcacaaaacgcacaaaaaggaagaaagtgacgtaa
Sequence Length
1203
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,851 Da
NCBI Official Full Name
Homo sapiens sirtuin (silent mating type information regulation 2 homolog) 7 (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
sirtuin 7
NCBI Official Symbol
SIRT7
NCBI Official Synonym Symbols
SIR2L7
NCBI Protein Information
NAD-dependent protein deacetylase sirtuin-7
UniProt Protein Name
NAD-dependent protein deacetylase sirtuin-7
UniProt Gene Name
SIRT7
UniProt Synonym Gene Names
SIR2L7
UniProt Entry Name
SIR7_HUMAN

NCBI Description

This gene encodes a member of the sirtuin family of proteins, homologs to the yeast Sir2 protein. Members of the sirtuin family are characterized by a sirtuin core domain and grouped into four classes. The functions of human sirtuins have not yet been determined; however, yeast sirtuin proteins are known to regulate epigenetic gene silencing and suppress recombination of rDNA. Studies suggest that the human sirtuins may function as intracellular regulatory proteins with mono-ADP-ribosyltransferase activity. The protein encoded by this gene is included in class IV of the sirtuin family. [provided by RefSeq, Jul 2008]

Uniprot Description

SIRT7: NAD-dependent protein deacetylase that specifically mediates deacetylation of histone H3 at 'Lys-18' (H3K18Ac). In contrast to other histone deacetylases, displays selectivity for a single histone mark, H3K18Ac, directly linked to control of gene expression. H3K18Ac is mainly present around the transcription start site of genes and has been linked to activation of nuclear hormone receptors. SIRT7 thereby acts as a transcription repressor. Moreover, H3K18 hypoacetylation has been reported as a marker of malignancy in various cancers and seems to maintain the transformed phenotype of cancer cells. These data suggest that SIRT7 may play a key role in oncogenic transformation by suppresses expression of tumor suppressor genes by locus-specific deacetylation of H3K18Ac at promoter regions. Also required to restore the transcription of ribosomal RNA (rRNA) at the exit from mitosis: promotes the association of RNA polymerase I with the rDNA promoter region and coding region. Stimulates transcription activity of the RNA polymerase I complex. May also deacetylate p53/TP53 and promotes cell survival, however such data need additional confirmation. Belongs to the sirtuin family. Class IV subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Nucleolus; Deacetylase; EC 3.5.1.-

Chromosomal Location of Human Ortholog: 17q25

Cellular Component: nucleolus; nucleolus organizer region

Molecular Function: chromatin binding; protein binding

Biological Process: activation of transcription on exit from mitosis; negative regulation of transcription from RNA polymerase II promoter; rRNA transcription

Research Articles on SIRT7

Similar Products

Product Notes

The SIRT7 sirt7 (Catalog #AAA1274602) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagccg ggggtctgag ccgctccgag cgcaaagcgg cggagcgggt ccggaggttg cgggaggagc agcagaggga gcgcctccgc caggtgtcgc gcatcctgag gaaggcggcg gcggagcgca gcgccgagga gggccggctg ctggccgaga gcgcggacct ggtaacggag ctgcagggcc ggagccggcg gcgcgagggc ctgaagcggc ggcaggagga ggtgtgcgac gacccggagg agctgcgggg gaaggtccgg gagctggcca gcgccgtccg gaacgccaaa tacttggtcg tctacacagg cgcgggaatc agcacggcag cgtctatccc agactaccgg ggccctaatg gagtgtggac actgcttcag aaagggagaa gcgttagtgc tgccgacctg agcgaggccg agccaaccct cacccacatg agcatcaccc gtctgcatga gcagaagctg gtgcagcatg tggtgtctca gaactgtgac gggctccacc tgaggagtgg gctgccgcgc acggccatct ccgagctcca cgggaacatg tacattgaag tctgtacctc ctgcgttccc aacagggagt acgtgcgggt gttcgatgtg acggagcgca ctgccctcca cagacaccag acaggccgga cctgccacaa gtgtgggacc cagctgcggg acaccattgt gcactttggg gagaggggga cgttggggca gcctctgaac tgggaagcgg cgaccgaggc tgccagcaga gcagacacca tcctgtgtct agggtccagc ctgaaggttc taaagaagta cccacgcctc tggtgcatga ccaagccccc tagccggcgg ccgaagcttt acatcgtgaa cctgcagtgg accccgaagg atgactgggc tgccctgaag ctacatggga agtgtgatga cgtcatgcgg ctcctcatgg ccgagctggg cttggagatc cccgcctata gcaggtggca ggatcccatt ttctcactgg cgactcccct gcgtgctggt gaagaaggca gccacagtcg gaagtcgctg tgcagaagca gagaggaggc cccgcctggg gaccggggtg caccgcttag ctcggccccc atcctagggg gctggtttgg caggggctgc acaaaacgca caaaaaggaa gaaagtgacg taa. It is sometimes possible for the material contained within the vial of "SIRT7, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.