Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SGK3 cdna clone

SGK3 cDNA Clone

Gene Names
SGK3; CISK; SGK2; SGKL
Synonyms
SGK3; SGK3 cDNA Clone; SGK3 cdna clone
Ordering
For Research Use Only!
Sequence
atgcaaagagatcacaccatggactacaaggaaagctgcccaagtgtaagcattcccagctccgatgaacacagagagaaaaagaagaggtttactgtttataaagttctggtttcagtgggaagaagtgaatggtttgtcttcaggagatatgcagagtttgataaactttataacactttaaaaaaacagtttcctgctatggccctgaagattcctgccaagagaatatttggtgataattttgatccagattttattaaacaaagacgagcaggactaaacgaattcattcagaacctagttaggtatccagaactttataaccatccagatgtcagagcattccttcaaatggacagtccaaaacaccagtcagatccatctgaagatgaggatgaaagaagttctcagaagctacactctacctcacagaacatcaacctgggaccgtctggaaatcctcatgccaaaccaactgactttgatttcttaaaagttattggaaaaggcagctttggcaaggttcttcttgcaaaacggaaactggatggaaaattttatgctgtcaaagtgttacagaaaaaaatagttctcaacagaaaagagcaaaaacatattatggctgaacgtaatgtgctcttgaaaaatgtgaaacatccgtttttggttggattgcattattccttccaaacaactgaaaagctttattttgttctggattttgttaatggaggggagctttttttccacttacaaagagaacggtcctttcctgagcacagagctaggttttacgctgctgaaattgctagtgcattgggttacttacattccatcaaaatagtatacagagacttgaaaccagaaaatattcttttggattcagtaggacatgttgtcttaacagattttgggctttgtaaagaaggaattgctatttctgacaccactaccacattttgtgggacaccagagtatcttgcacctgaagtaattagaaaacagccctatgacaatactgtagattggtggtgccttggggctgttctgtatgaaatgctgtatggattgcctcctttttattgccgagatgttgctgaaatgtatgacaatatccttcacaaacccctaagtttgaggccaggagtgagtcttacagcctggtccattctggaagaactcctagaaaaagacaggcaaaatcgacttggtgccaaggaagactttcttgaaattcagaatcatcctttttttgaatcactcagctgggctgaccttgtacaaaagaagattccaccaccatttaatcctaatgtggctggaccagatgatatcagaaactttgacacagcatttacagaagaaacagttccatattctgtgtgtgtatcttctgactattctatagtgaatgccagtgtattggaggcagatgatgcattcgttggtttctcttatgcacctccttcagaagacttatttttgtga
Sequence Length
1491
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,306 Da
NCBI Official Full Name
Homo sapiens serum/glucocorticoid regulated kinase family, member 3, mRNA
NCBI Official Synonym Full Names
serum/glucocorticoid regulated kinase family member 3
NCBI Official Symbol
SGK3
NCBI Official Synonym Symbols
CISK; SGK2; SGKL
NCBI Protein Information
serine/threonine-protein kinase Sgk3
UniProt Protein Name
Serine/threonine-protein kinase Sgk3
UniProt Gene Name
SGK3
UniProt Synonym Gene Names
CISK; SGKL
UniProt Entry Name
SGK3_HUMAN

NCBI Description

This gene is a member of the Ser/Thr protein kinase family and encodes a phosphoprotein with a PX (phox homology) domain. The protein phosphorylates several target proteins and has a role in neutral amino acid transport and activation of potassium and chloride channels. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

SGK3: Serine/threonine-protein kinase which is involved in the regulation of a wide variety of ion channels, membrane transporters, cell growth, proliferation, survival and migration. Up-regulates Na(+) channels: SCNN1A/ENAC and SCN5A, K(+) channels: KCNA3/KV1.3, KCNE1, KCNQ1 and KCNH2/HERG, epithelial Ca(2+) channels: TRPV5 and TRPV6, chloride channel: BSND, creatine transporter: SLC6A8, Na(+)/dicarboxylate cotransporter: SLC13A2/NADC1, Na(+)-dependent phosphate cotransporter: SLC34A2/NAPI-2B, amino acid transporters: SLC1A5/ASCT2 and SLC6A19, glutamate transporters: SLC1A3/EAAT1, SLC1A6/EAAT4 and SLC1A7/EAAT5, glutamate receptors: GRIA1/GLUR1 and GRIK2/GLUR6, Na(+)/H(+) exchanger: SLC9A3/NHE3, and the Na(+)/K(+) ATPase. Plays a role in the regulation of renal tubular phosphate transport and bone density. Phosphorylates NEDD4L and GSK3B. Positively regulates ER transcription activity through phosphorylation of FLII. Negatively regulates the function of ITCH/AIP4 via its phosphorylation and thereby prevents CXCR4 from being efficiently sorted to lysosomes. Interacts with GSK3B and FLII. Interacts with PDPK1 in a phosphorylation-dependent manner. Induced by estrogen/ER in breast cancer cells. Expressed in most tissues with highest levels in pancreas, kidney liver, heart and brain and lower levels in lung, placenta and skeletal muscle. Expression is higher in ER- positive breast tumors than ER-negative breast tumors. Two specific sites, one in the kinase domain (Thr-320) and the other in the C-terminal regulatory region (Ser- 486), need to be phosphorylated for its full activation. Belongs to the protein kinase superfamily. AGC Ser/Thr protein kinase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Protein kinase, AGC; EC 2.7.11.1; Kinase, protein; Protein kinase, Ser/Thr (non-receptor); AGC group; SGK family

Chromosomal Location of Human Ortholog: 8q12

Cellular Component: cytoplasmic membrane-bound vesicle; cytosol

Molecular Function: calcium channel regulator activity; chloride channel regulator activity; potassium channel regulator activity; protein binding; protein kinase activity; sodium channel regulator activity

Biological Process: cellular sodium ion homeostasis; peptidyl-serine phosphorylation; positive regulation of transporter activity; protein amino acid phosphorylation; regulation of apoptosis; regulation of cell growth; regulation of cell migration; regulation of cell proliferation; regulation of transcription factor activity; response to stress

Research Articles on SGK3

Similar Products

Product Notes

The SGK3 sgk3 (Catalog #AAA1269303) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaaagag atcacaccat ggactacaag gaaagctgcc caagtgtaag cattcccagc tccgatgaac acagagagaa aaagaagagg tttactgttt ataaagttct ggtttcagtg ggaagaagtg aatggtttgt cttcaggaga tatgcagagt ttgataaact ttataacact ttaaaaaaac agtttcctgc tatggccctg aagattcctg ccaagagaat atttggtgat aattttgatc cagattttat taaacaaaga cgagcaggac taaacgaatt cattcagaac ctagttaggt atccagaact ttataaccat ccagatgtca gagcattcct tcaaatggac agtccaaaac accagtcaga tccatctgaa gatgaggatg aaagaagttc tcagaagcta cactctacct cacagaacat caacctggga ccgtctggaa atcctcatgc caaaccaact gactttgatt tcttaaaagt tattggaaaa ggcagctttg gcaaggttct tcttgcaaaa cggaaactgg atggaaaatt ttatgctgtc aaagtgttac agaaaaaaat agttctcaac agaaaagagc aaaaacatat tatggctgaa cgtaatgtgc tcttgaaaaa tgtgaaacat ccgtttttgg ttggattgca ttattccttc caaacaactg aaaagcttta ttttgttctg gattttgtta atggagggga gctttttttc cacttacaaa gagaacggtc ctttcctgag cacagagcta ggttttacgc tgctgaaatt gctagtgcat tgggttactt acattccatc aaaatagtat acagagactt gaaaccagaa aatattcttt tggattcagt aggacatgtt gtcttaacag attttgggct ttgtaaagaa ggaattgcta tttctgacac cactaccaca ttttgtggga caccagagta tcttgcacct gaagtaatta gaaaacagcc ctatgacaat actgtagatt ggtggtgcct tggggctgtt ctgtatgaaa tgctgtatgg attgcctcct ttttattgcc gagatgttgc tgaaatgtat gacaatatcc ttcacaaacc cctaagtttg aggccaggag tgagtcttac agcctggtcc attctggaag aactcctaga aaaagacagg caaaatcgac ttggtgccaa ggaagacttt cttgaaattc agaatcatcc tttttttgaa tcactcagct gggctgacct tgtacaaaag aagattccac caccatttaa tcctaatgtg gctggaccag atgatatcag aaactttgac acagcattta cagaagaaac agttccatat tctgtgtgtg tatcttctga ctattctata gtgaatgcca gtgtattgga ggcagatgat gcattcgttg gtttctctta tgcacctcct tcagaagact tatttttgtg a. It is sometimes possible for the material contained within the vial of "SGK3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.