Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SGK1 cdna clone

SGK1 cDNA Clone

Gene Names
SGK1; SGK
Synonyms
SGK1; SGK1 cDNA Clone; SGK1 cdna clone
Ordering
For Research Use Only!
Sequence
atgacggtgaaaactgaggctgctaagggcaccctcacttactccaggatgaggggcatggtggcaattctcatcgctttcatgaagcagaggaggatgggtctgaacgactttattcagaagattgccaataactcctatgcatgcaaacaccctgaagttcagtccatcttgaagatctcccaacctcaggagcctgagcttatgaatgccaacccttctcctccaccaagtccttctcagcaaatcaaccttggcccgtcgtccaatcctcatgctaaaccatctgactttcacttcttgaaagtgatcggaaagggcagttttggaaaggttcttctagcaagacacaaggcagaagaagtgttctatgcagtcaaagttttacagaagaaagcaatcctgaaaaagaaagaggagaagcatattatgtcggagcggaatgttctgttgaagaatgtgaagcaccctttcctggtgggccttcacttctctttccagactgctgacaaattgtactttgtcctagactacattaatggtggagagttgttctaccatctccagagggaacgctgcttcctggaaccacgggctcgtttctatgctgctgaaatagccagtgccttgggctacctgcattcactgaacatcgtttatagagacttaaaaccagagaatattttgctagattcacagggacacattgtccttactgacttcggactctgcaaggagaacattgaacacaacagcacaacatccaccttctgtggcacgccggagtatctcgcacctgaggtgcttcataagcagccttatgacaggactgtggactggtggtgcctgggagctgtcttgtatgagatgctgtatggcctgccgcctttttatagccgaaacacagctgaaatgtacgacaacattctgaacaagcctctccagctgaaaccaaatattacaaattccgcaagacacctcctggagggcctcctgcagaaggacaggacaaagcggctcggggccaaggatgacttcatggagattaagagtcatgtcttcttctccttaattaactgggatgatctcattaataagaagattactcccccttttaacccaaatgtgagtgggcccaacgacctacggcactttgaccccgagtttaccgaagagcctgtccccaactccattggcaagtcccctgacagcgtcctcgtcacagccagcgtcaaggaagctgccgaggctttcctaggcttttcctatgcgcctcccacggactctttcctctga
Sequence Length
1296
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
52,119 Da
NCBI Official Full Name
Homo sapiens serum/glucocorticoid regulated kinase 1, mRNA
NCBI Official Synonym Full Names
serum/glucocorticoid regulated kinase 1
NCBI Official Symbol
SGK1
NCBI Official Synonym Symbols
SGK
NCBI Protein Information
serine/threonine-protein kinase Sgk1
UniProt Protein Name
Serine/threonine-protein kinase Sgk1
UniProt Gene Name
SGK1
UniProt Synonym Gene Names
SGK
UniProt Entry Name
SGK1_HUMAN

NCBI Description

This gene encodes a serine/threonine protein kinase that plays an important role in cellular stress response. This kinase activates certain potassium, sodium, and chloride channels, suggesting an involvement in the regulation of processes such as cell survival, neuronal excitability, and renal sodium excretion. High levels of expression of this gene may contribute to conditions such as hypertension and diabetic nephropathy. Several alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2009]

Uniprot Description

SGK1: serum and glucocorticoid-inducible kinase is an AGC protein kinase of the SGK family. Rapidly induced in response to a variety of stimuli including serum, glucocorticoids, follicle stimulating hormone, osmotic shock and mineralocorticoids. Can be activated via PI3K-dependent and -independent pathways. Plays a role in activating certain potassium, sodium and chloride channels, suggesting an involvement in the regulation of processes such as cell survival, neuronal excitability and renal sodium excretion. SGK is negatively regulated by ubiquitin modification and proteasome degradation.

Protein type: Protein kinase, Ser/Thr (non-receptor); Protein kinase, AGC; Kinase, protein; Motility/polarity/chemotaxis; EC 2.7.11.1; AGC group; SGK family

Chromosomal Location of Human Ortholog: 6q23

Cellular Component: cytoplasm; cytosol; nucleoplasm; nucleus

Molecular Function: calcium channel regulator activity; chloride channel regulator activity; potassium channel regulator activity; protein binding; protein serine/threonine kinase activity; protein serine/threonine/tyrosine kinase activity; sodium channel regulator activity

Biological Process: cellular sodium ion homeostasis; long-term memory; neurite morphogenesis; peptidyl-serine phosphorylation; positive regulation of transporter activity; protein amino acid phosphorylation; regulation of apoptosis; regulation of blood pressure; regulation of catalytic activity; regulation of cell growth; regulation of cell migration; regulation of cell proliferation; regulation of transcription factor activity; response to stress; sodium ion transport

Research Articles on SGK1

Similar Products

Product Notes

The SGK1 sgk1 (Catalog #AAA1266457) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacggtga aaactgaggc tgctaagggc accctcactt actccaggat gaggggcatg gtggcaattc tcatcgcttt catgaagcag aggaggatgg gtctgaacga ctttattcag aagattgcca ataactccta tgcatgcaaa caccctgaag ttcagtccat cttgaagatc tcccaacctc aggagcctga gcttatgaat gccaaccctt ctcctccacc aagtccttct cagcaaatca accttggccc gtcgtccaat cctcatgcta aaccatctga ctttcacttc ttgaaagtga tcggaaaggg cagttttgga aaggttcttc tagcaagaca caaggcagaa gaagtgttct atgcagtcaa agttttacag aagaaagcaa tcctgaaaaa gaaagaggag aagcatatta tgtcggagcg gaatgttctg ttgaagaatg tgaagcaccc tttcctggtg ggccttcact tctctttcca gactgctgac aaattgtact ttgtcctaga ctacattaat ggtggagagt tgttctacca tctccagagg gaacgctgct tcctggaacc acgggctcgt ttctatgctg ctgaaatagc cagtgccttg ggctacctgc attcactgaa catcgtttat agagacttaa aaccagagaa tattttgcta gattcacagg gacacattgt ccttactgac ttcggactct gcaaggagaa cattgaacac aacagcacaa catccacctt ctgtggcacg ccggagtatc tcgcacctga ggtgcttcat aagcagcctt atgacaggac tgtggactgg tggtgcctgg gagctgtctt gtatgagatg ctgtatggcc tgccgccttt ttatagccga aacacagctg aaatgtacga caacattctg aacaagcctc tccagctgaa accaaatatt acaaattccg caagacacct cctggagggc ctcctgcaga aggacaggac aaagcggctc ggggccaagg atgacttcat ggagattaag agtcatgtct tcttctcctt aattaactgg gatgatctca ttaataagaa gattactccc ccttttaacc caaatgtgag tgggcccaac gacctacggc actttgaccc cgagtttacc gaagagcctg tccccaactc cattggcaag tcccctgaca gcgtcctcgt cacagccagc gtcaaggaag ctgccgaggc tttcctaggc ttttcctatg cgcctcccac ggactctttc ctctga. It is sometimes possible for the material contained within the vial of "SGK1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.