Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SF3B14 cdna clone

SF3B14 cDNA Clone

Gene Names
SF3B6; P14; Ht006; SAP14; SAP14a; SF3B14; CGI-110; HSPC175; SF3B14a
Synonyms
SF3B14; SF3B14 cDNA Clone; SF3B14 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgatgcaagcggccaagagggcgaacattcgacttccacctgaagtaaatcggatattgtatataagaaatttgccatacaaaatcacagctgaagaaatgtatgatatatttgggaaatatggacctattcgtcaaatcagagtggggaacacacctgaaactagaggaacagcttatgtggtctatgaggacatctttgatgccaagaatgcatgtgatcacctatcgggattcaatgtttgtaacagataccttgtggttttgtactataatgccaacagggcatttcagaagatggacacaaagaagaaggaggaacagttgaagcttctcaaggagaaatatggcatcaacacagatccaccaaaataa
Sequence Length
378
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
14,585 Da
NCBI Official Full Name
Homo sapiens splicing factor 3B, 14 kDa subunit, mRNA
NCBI Official Synonym Full Names
splicing factor 3b subunit 6
NCBI Official Symbol
SF3B6
NCBI Official Synonym Symbols
P14; Ht006; SAP14; SAP14a; SF3B14; CGI-110; HSPC175; SF3B14a
NCBI Protein Information
splicing factor 3B subunit 6
UniProt Protein Name
Splicing factor 3B subunit 6
UniProt Gene Name
SF3B6
UniProt Synonym Gene Names
SAP14; SF3B14; SF3B14A; SF3B14a
UniProt Entry Name
SF3B6_HUMAN

NCBI Description

This gene encodes a 14 kDa protein subunit of the splicing factor 3b complex. Splicing factor 3b associates with both the U2 and U11/U12 small nuclear ribonucleoprotein complexes (U2 snRNP) of spliceosomes. This 14 kDa protein interacts directly with subunit 1 of the splicing factor 3b complex. This 14 kDa protein also interacts directly with the adenosine that carries out the first transesterification step of splicing at the pre-mRNA branch site. [provided by RefSeq, Jul 2008]

Uniprot Description

SF3B6: subunit of the splicing factor SF3B. Necessary for the splicing of pre-mRNA. Directly contacts the pre-mRNA branch site adenosine for the first catalytic step of splicing. Enters the spliceosome and associates with the pre-mRNA branch site as part of the 17S U2 or, in the case of the minor spliceosome, as part of the 18S U11/U12 snRNP complex, and thus may facilitate the interaction of these snRNP with the branch sites of U2 and U12 respectively.

Protein type: RNA-binding; Spliceosome; RNA splicing

Chromosomal Location of Human Ortholog: 2p23

Cellular Component: nucleoplasm; snRNP U2; U12-dependent spliceosome

Biological Process: nuclear mRNA splicing, via spliceosome

Research Articles on SF3B14

Similar Products

Product Notes

The SF3B14 sf3b6 (Catalog #AAA1268794) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgatgc aagcggccaa gagggcgaac attcgacttc cacctgaagt aaatcggata ttgtatataa gaaatttgcc atacaaaatc acagctgaag aaatgtatga tatatttggg aaatatggac ctattcgtca aatcagagtg gggaacacac ctgaaactag aggaacagct tatgtggtct atgaggacat ctttgatgcc aagaatgcat gtgatcacct atcgggattc aatgtttgta acagatacct tgtggttttg tactataatg ccaacagggc atttcagaag atggacacaa agaagaagga ggaacagttg aagcttctca aggagaaata tggcatcaac acagatccac caaaataa. It is sometimes possible for the material contained within the vial of "SF3B14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.