Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SETMAR cdna clone

SETMAR cDNA Clone

Gene Names
SETMAR; Mar1; METNASE
Synonyms
SETMAR; SETMAR cDNA Clone; SETMAR cdna clone
Ordering
For Research Use Only!
Sequence
atggcggagtttaaggagaagcctgaggccccgactgagcagctggatgtcgcgtgcggccaggaaaacttgccggtgggcgcgtggcccccgggggccgcgccggcgcccttccagtacactcctgatcatgtagttggacctggagcagacattgatcccactcaaataacctttcccggatgcatttgtgtcaaaactccctgcctccctggcacttgctcctgtctccgccatggagagaactatgatgataactcatgccttagagatataggatctggaggaaagtatgcagagcctgtttttgaatgcaatgtcctgtgccgatgcagtgaccactgcagaaacagagtggtccagaaaggtctacagttccacttccaagtgttcaagacgcataaaaaaggctggggacttcgtaccttggaatttataccgaaaggaaggtttgtctgtgaatatgctggtgaggttttaggattctctgaagttcagagaagaattcacttacaaacaaaatccgactccaattacattatagccatcagggaacatgtttataatgggcaggtaatggaaacatttgttgaccctacttatataggaaatattggaagattccttaatcattcttgtgagccaaaccttttgatgattcctgtccgaattgactcaatggtacctaagttggcactttttgcagccaaagatattgtgccagaagaagaactctcttatgattattcaggaagatatcttaatctaacagtcagtgaagacaaagaaaggctagatcatgggaaactaaggaaaccttgttactgtggtgccaaatcatgtactgctttcctgccttttgacagttctctgtactgccccgtagaaaagtcgaacatcagttgtggaaatgagaaggaacccagcatgtgtggctcagccccttctgtgttcccctcctgcaagcgattgacccttgaggtgagtctgttcagtgataagcagcttgcccctccctatagtggaagacagtggttggctagctttacctctgcctag
Sequence Length
1059
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
62,124 Da
NCBI Official Full Name
Homo sapiens SET domain and mariner transposase fusion gene, mRNA
NCBI Official Synonym Full Names
SET domain and mariner transposase fusion gene
NCBI Official Symbol
SETMAR
NCBI Official Synonym Symbols
Mar1; METNASE
NCBI Protein Information
histone-lysine N-methyltransferase SETMAR
UniProt Protein Name
Histone-lysine N-methyltransferase SETMAR
UniProt Gene Name
SETMAR
UniProt Synonym Gene Names
Metnase
UniProt Entry Name
SETMR_HUMAN

NCBI Description

This gene encodes a fusion protein that contains an N-terminal histone-lysine N-methyltransferase domain and a C-terminal mariner transposase domain. The encoded protein binds DNA and functions in DNA repair activities including non-homologous end joining and double strand break repair. The SET domain portion of this protein specifically methylates histone H3 lysines 4 and 36. This gene exists as a fusion gene only in anthropoid primates, other organisms lack mariner transposase domain. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]

Uniprot Description

SETMAR: Histone methyltransferase that methylates 'Lys-4' and 'Lys-36' of histone H3, 2 specific tags for epigenetic transcriptional activation. Specifically mediates dimethylation of H3 'Lys-36'. Has sequence-specific DNA-binding activity and recognizes the 19-mer core of the 5'-terminal inverted repeats (TIRs) of the Hsmar1 element. Has DNA nicking activity. Has in vivo end joining activity and may mediate genomic integration of foreign DNA. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Methyltransferase; Methyltransferase, protein lysine; EC 2.1.1.43; Amino Acid Metabolism - lysine degradation

Chromosomal Location of Human Ortholog: 3p26.1

Cellular Component: condensed chromosome; nucleus

Molecular Function: double-stranded DNA binding; endonuclease activity; histone lysine N-methyltransferase activity (H3-K36 specific); histone lysine N-methyltransferase activity (H3-K4 specific); protein binding; protein homodimerization activity; single-stranded DNA binding; single-stranded DNA specific endodeoxyribonuclease activity; structure-specific DNA binding

Biological Process: cell proliferation; DNA catabolic process, endonucleolytic; DNA double-strand break processing; DNA integration; double-strand break repair via nonhomologous end joining; histone H3-K36 methylation; histone H3-K4 methylation; replication fork processing

Research Articles on SETMAR

Similar Products

Product Notes

The SETMAR setmar (Catalog #AAA1266962) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggagt ttaaggagaa gcctgaggcc ccgactgagc agctggatgt cgcgtgcggc caggaaaact tgccggtggg cgcgtggccc ccgggggccg cgccggcgcc cttccagtac actcctgatc atgtagttgg acctggagca gacattgatc ccactcaaat aacctttccc ggatgcattt gtgtcaaaac tccctgcctc cctggcactt gctcctgtct ccgccatgga gagaactatg atgataactc atgccttaga gatataggat ctggaggaaa gtatgcagag cctgtttttg aatgcaatgt cctgtgccga tgcagtgacc actgcagaaa cagagtggtc cagaaaggtc tacagttcca cttccaagtg ttcaagacgc ataaaaaagg ctggggactt cgtaccttgg aatttatacc gaaaggaagg tttgtctgtg aatatgctgg tgaggtttta ggattctctg aagttcagag aagaattcac ttacaaacaa aatccgactc caattacatt atagccatca gggaacatgt ttataatggg caggtaatgg aaacatttgt tgaccctact tatataggaa atattggaag attccttaat cattcttgtg agccaaacct tttgatgatt cctgtccgaa ttgactcaat ggtacctaag ttggcacttt ttgcagccaa agatattgtg ccagaagaag aactctctta tgattattca ggaagatatc ttaatctaac agtcagtgaa gacaaagaaa ggctagatca tgggaaacta aggaaacctt gttactgtgg tgccaaatca tgtactgctt tcctgccttt tgacagttct ctgtactgcc ccgtagaaaa gtcgaacatc agttgtggaa atgagaagga acccagcatg tgtggctcag ccccttctgt gttcccctcc tgcaagcgat tgacccttga ggtgagtctg ttcagtgata agcagcttgc ccctccctat agtggaagac agtggttggc tagctttacc tctgcctag. It is sometimes possible for the material contained within the vial of "SETMAR, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.