Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SERPINC1 cdna clone

SERPINC1 cDNA Clone

Gene Names
SERPINC1; AT3; AT3D; ATIII; THPH7
Synonyms
SERPINC1; SERPINC1 cDNA Clone; SERPINC1 cdna clone
Ordering
For Research Use Only!
Sequence
atgtattccaatgtgataggaactgtaacctctggaaaaaggaaggtttatcttttgtccttgctgctcattggcttctgggactgcgtgacctgtcacgggagccctgtggacatctgcacagccaagccgcgggacattcccatgaatcccatgtgcatttaccgctccccggagaagaaggcaactgaggatgagggctcagaacagaagatcccggaggccaccaaccggcgtgtctgggaactgtccaaggccaattcccgctttgctaccactttctatcagcacctggcagattccaagaatgacaatgataacattttcctgtcacccctgagtatctccacggcttttgctatgaccaagctgggtgcctgtaatgacaccctccagcaactgatggaggtatttaagtttgacaccatatctgagaaaacatctgatcagatccacttcttctttgccaaactgaactgccgactctatcgaaaagccaacaaatcctccaagttagtatcagccaatcgcctttttggagacaaatcccttaccttcaatgacctctatgtctcagatgcattccataaggcatttcttgaggtaaatgaagaaggcagtgaagcagctgcaagtaccgctgttgtgattgctggccgttcgctaaaccccaacagggtgactttcaaggccaacaggcctttcctggtttttataagagaagttcctctgaacactattatcttcatgggcagagtagccaacccttgtgttaagtaa
Sequence Length
780
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
462
Molecular Weight
52,602 Da
NCBI Official Full Name
Homo sapiens serpin peptidase inhibitor, clade C (antithrombin), member 1, mRNA
NCBI Official Synonym Full Names
serpin family C member 1
NCBI Official Symbol
SERPINC1
NCBI Official Synonym Symbols
AT3; AT3D; ATIII; THPH7
NCBI Protein Information
antithrombin-III
UniProt Protein Name
Antithrombin-III
Protein Family
UniProt Gene Name
SERPINC1
UniProt Synonym Gene Names
AT3; ATIII
UniProt Entry Name
ANT3_HUMAN

NCBI Description

The protein encoded by this gene is a plasma protease inhibitor and a member of the serpin superfamily. This protein inhibits thrombin as well as other activated serine proteases of the coagulation system, and it regulates the blood coagulation cascade. The protein includes two functional domains: the heparin binding-domain at the N-terminus of the mature protein, and the reactive site domain at the C-terminus. The inhibitory activity is enhanced by the presence of heparin. More than 120 mutations have been identified for this gene, many of which are known to cause antithrombin-III deficiency. [provided by RefSeq, Jul 2009]

Uniprot Description

SERPINC1: Most important serine protease inhibitor in plasma that regulates the blood coagulation cascade. AT-III inhibits thrombin, matriptase-3/TMPRSS7, as well as factors IXa, Xa and XIa. Its inhibitory activity is greatly enhanced in the presence of heparin. Defects in SERPINC1 are the cause of antithrombin III deficiency (AT3D). AT3D is an important risk factor for hereditary thrombophilia, a hemostatic disorder characterized by a tendency to recurrent thrombosis. AT3D is classified into 4 types. Type I: characterized by a 50% decrease in antigenic and functional levels. Type II: has defects affecting the thrombin- binding domain. Type III: alteration of the heparin-binding domain. Plasma AT-III antigen levels are normal in type II and III. Type IV: consists of miscellaneous group of unclassifiable mutations. Belongs to the serpin family.

Protein type: Inhibitor; Secreted; Secreted, signal peptide

Chromosomal Location of Human Ortholog: 1q25.1

Cellular Component: extracellular region; extracellular space; plasma membrane

Molecular Function: protease binding; protein binding; serine-type endopeptidase inhibitor activity

Biological Process: blood coagulation

Disease: Antithrombin Iii Deficiency

Research Articles on SERPINC1

Similar Products

Product Notes

The SERPINC1 serpinc1 (Catalog #AAA1268361) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtattcca atgtgatagg aactgtaacc tctggaaaaa ggaaggttta tcttttgtcc ttgctgctca ttggcttctg ggactgcgtg acctgtcacg ggagccctgt ggacatctgc acagccaagc cgcgggacat tcccatgaat cccatgtgca tttaccgctc cccggagaag aaggcaactg aggatgaggg ctcagaacag aagatcccgg aggccaccaa ccggcgtgtc tgggaactgt ccaaggccaa ttcccgcttt gctaccactt tctatcagca cctggcagat tccaagaatg acaatgataa cattttcctg tcacccctga gtatctccac ggcttttgct atgaccaagc tgggtgcctg taatgacacc ctccagcaac tgatggaggt atttaagttt gacaccatat ctgagaaaac atctgatcag atccacttct tctttgccaa actgaactgc cgactctatc gaaaagccaa caaatcctcc aagttagtat cagccaatcg cctttttgga gacaaatccc ttaccttcaa tgacctctat gtctcagatg cattccataa ggcatttctt gaggtaaatg aagaaggcag tgaagcagct gcaagtaccg ctgttgtgat tgctggccgt tcgctaaacc ccaacagggt gactttcaag gccaacaggc ctttcctggt ttttataaga gaagttcctc tgaacactat tatcttcatg ggcagagtag ccaacccttg tgttaagtaa. It is sometimes possible for the material contained within the vial of "SERPINC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.