Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SERPINA12 cdna clone

SERPINA12 cDNA Clone

Gene Names
SERPINA12; OL-64
Synonyms
SERPINA12; SERPINA12 cDNA Clone; SERPINA12 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaccccacactaggcctggccatttttctggctgttctcctcacggtgaaaggtcttctaaagccgagcttctcaccaaggaattataaagctttgagcgaggtccaaggatggaagcaaaggatggcagccaaggagcttgcaaggcagaacatggacttaggctttaagctgctcaagaagctggccttttacaaccctggcaggaacatcttcctatcccccttgagcatctctacagctttctccatgctgtgcctgggtgcccaggacagcaccctggacgagatcaagcaggggttcaacttcagaaagatgccagaaaaagatcttcatgagggcttccattacatcatccacgagctgacccagaagacccaggacctcaaactgagcattgggaacacgctgttcattgaccagaggctgcagccacagcgtaagtttttggaagatgccaagaacttttacagtgccgaaaccatccttaccaactttcagaatttggaaatggctcagaagcagatcaatgactttatcagtcaaaaaacccatgggaaaattaacaacctgatcgagaatatagaccccggcactgtgatgcttcttgcaaattatattttctttcgagccaggtggaaacatgagtttgatccaaatgtaactaaagaggaagatttctttctggagaaaaacagttcagtcaaggtgcccatgatgttccgtagtggcatataccaagttggctatgacgataagctctcttgcaccatcctggaaataccctaccagaaaaatatcacagccatcttcatccttcctgatgagggcaagctgaagcacttggagaagggattgcaggtggacactttctccagatggaaaacattactgtcacgcagggtcgtagacgtgtctgtacccagactccacatgacgggcaccttcgacctgaagaagactctctcctacataggtgtctccaaaatctttgaggaacatggtgatctcaccaagatcgcccctcatcgcagcctgaaagtgggcgaggctgtgcacaaggctgagctgaagatggatgagaggggtacggaaggggccgctggcaccggagcacagactctgcccatggagacaccactcgtcgtcaagatagacaaaccctatctgctgctgatttacagcgagaaaataccttccgtgctcttcctgggaaagattgttaaccctattggaaaataa
Sequence Length
1245
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,175 Da
NCBI Official Full Name
Homo sapiens serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12, mRNA
NCBI Official Synonym Full Names
serpin family A member 12
NCBI Official Symbol
SERPINA12
NCBI Official Synonym Symbols
OL-64
NCBI Protein Information
serpin A12
UniProt Protein Name
Serpin A12
Protein Family
UniProt Gene Name
SERPINA12
UniProt Synonym Gene Names
Vaspin
UniProt Entry Name
SPA12_HUMAN

Uniprot Description

SERPINA12: May modulate insulin action conceivably only in the presence of its yet undefined target proteases in white adipose tissues. Belongs to the serpin family.

Protein type: Inhibitor; Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 14q32.13

Cellular Component: extracellular space

Molecular Function: serine-type endopeptidase inhibitor activity

Research Articles on SERPINA12

Similar Products

Product Notes

The SERPINA12 serpina12 (Catalog #AAA1265989) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacccca cactaggcct ggccattttt ctggctgttc tcctcacggt gaaaggtctt ctaaagccga gcttctcacc aaggaattat aaagctttga gcgaggtcca aggatggaag caaaggatgg cagccaagga gcttgcaagg cagaacatgg acttaggctt taagctgctc aagaagctgg ccttttacaa ccctggcagg aacatcttcc tatccccctt gagcatctct acagctttct ccatgctgtg cctgggtgcc caggacagca ccctggacga gatcaagcag gggttcaact tcagaaagat gccagaaaaa gatcttcatg agggcttcca ttacatcatc cacgagctga cccagaagac ccaggacctc aaactgagca ttgggaacac gctgttcatt gaccagaggc tgcagccaca gcgtaagttt ttggaagatg ccaagaactt ttacagtgcc gaaaccatcc ttaccaactt tcagaatttg gaaatggctc agaagcagat caatgacttt atcagtcaaa aaacccatgg gaaaattaac aacctgatcg agaatataga ccccggcact gtgatgcttc ttgcaaatta tattttcttt cgagccaggt ggaaacatga gtttgatcca aatgtaacta aagaggaaga tttctttctg gagaaaaaca gttcagtcaa ggtgcccatg atgttccgta gtggcatata ccaagttggc tatgacgata agctctcttg caccatcctg gaaataccct accagaaaaa tatcacagcc atcttcatcc ttcctgatga gggcaagctg aagcacttgg agaagggatt gcaggtggac actttctcca gatggaaaac attactgtca cgcagggtcg tagacgtgtc tgtacccaga ctccacatga cgggcacctt cgacctgaag aagactctct cctacatagg tgtctccaaa atctttgagg aacatggtga tctcaccaag atcgcccctc atcgcagcct gaaagtgggc gaggctgtgc acaaggctga gctgaagatg gatgagaggg gtacggaagg ggccgctggc accggagcac agactctgcc catggagaca ccactcgtcg tcaagataga caaaccctat ctgctgctga tttacagcga gaaaatacct tccgtgctct tcctgggaaa gattgttaac cctattggaa aataa. It is sometimes possible for the material contained within the vial of "SERPINA12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.