SEC31B cdna clone
SEC31B cDNA Clone
Gene Names
SEC31B; SEC31L2; SEC31B-1
Synonyms
SEC31B; SEC31B cDNA Clone; SEC31B cdna clone
Sequence
atgaagctgaaggaacttgagcggccagctgtccaggcatggagcccagccagccaataccctttgtatctggccacaggaacatctgcccaacagctagattcctccttcagcacaaatggcacattggaaatatttgaggttgatttcagggacccttctctggacttgaaacacagaggagtcctttctgccttgagcaggtttcacaagctggtctgggggagctttggcagtgggcttctggaaagctccggggttattgctggcggcggggacaatggcatgcttattctatacaatgtgacccacatcctgtcttcggggaaggagcctgtgattgctcagaaacagaagcacacgggggctgtcagagccctcgactttaatcctttccagggcaacctcctggcttcaggggccagcgattctgaaatcttcatttgggatctgaataacttgaatgtgccaatgaccctgggatccaagtcacagcctccagaggacatcaaggcactgtcttggaaccggcaagcccaacacattctgtcttctgctcaccccagtggcaaggcagttgtgtgggatctcaggaagaatgaacctatcatcaaagtcagtgatcacagcaacaggatgcactgctcaggcctggcctggcatcctgacatagccacccagttagtgctgtgctcagaggatgatcgacttcccgtgattcagctgtgggacttgcgctttgcctcctcgcccttgaaggtgctggagagccacagcagggggatcttgtcagtgtcatggagccaggctgatgctgagctgctgctcactagtgctaaggacagccagatcttgtgccggaacctggggagcagtgaggtggtatataagctaccaacacagagcagctggtgctttgatgtgcagtggtgccctcgggacccttcagtgttctctgctgcctccttcaacggctggatcagtttgtacgctgtgatgggtaggagctgggaagtccagcacatgagacaggctgacaaggtttga
Sequence Length
1047
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
128,569 Da
NCBI Official Full Name
Homo sapiens SEC31 homolog B (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
SEC31 homolog B, COPII coat complex component
NCBI Official Symbol
SEC31B
NCBI Official Synonym Symbols
SEC31L2; SEC31B-1
NCBI Protein Information
protein transport protein Sec31B
UniProt Protein Name
Protein transport protein Sec31B
Protein Family
UniProt Gene Name
SEC31B
UniProt Synonym Gene Names
SEC31L2
UniProt Entry Name
SC31B_HUMAN
NCBI Description
This gene encodes a protein of unknown function. The protein has moderate similarity to rat VAP1 protein which is an endosomal membrane-associated protein, containing a putative Ca2+/calmodulin-dependent kinase II phosphorylation site. [provided by RefSeq, Jul 2008]
Uniprot Description
SEC31B: As a component of the coat protein complex II (COPII), may function in vesicle budding and cargo export from the endoplasmic reticulum. Belongs to the WD repeat SEC31 family. 5 isoforms of the human protein are produced by alternative splicing.
Chromosomal Location of Human Ortholog: 10q24.31
Research Articles on SEC31B
Similar Products
Product Notes
The SEC31B sec31b (Catalog #AAA1267056) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaagctga aggaacttga gcggccagct gtccaggcat ggagcccagc cagccaatac cctttgtatc tggccacagg aacatctgcc caacagctag attcctcctt cagcacaaat ggcacattgg aaatatttga ggttgatttc agggaccctt ctctggactt gaaacacaga ggagtccttt ctgccttgag caggtttcac aagctggtct gggggagctt tggcagtggg cttctggaaa gctccggggt tattgctggc ggcggggaca atggcatgct tattctatac aatgtgaccc acatcctgtc ttcggggaag gagcctgtga ttgctcagaa acagaagcac acgggggctg tcagagccct cgactttaat cctttccagg gcaacctcct ggcttcaggg gccagcgatt ctgaaatctt catttgggat ctgaataact tgaatgtgcc aatgaccctg ggatccaagt cacagcctcc agaggacatc aaggcactgt cttggaaccg gcaagcccaa cacattctgt cttctgctca ccccagtggc aaggcagttg tgtgggatct caggaagaat gaacctatca tcaaagtcag tgatcacagc aacaggatgc actgctcagg cctggcctgg catcctgaca tagccaccca gttagtgctg tgctcagagg atgatcgact tcccgtgatt cagctgtggg acttgcgctt tgcctcctcg cccttgaagg tgctggagag ccacagcagg gggatcttgt cagtgtcatg gagccaggct gatgctgagc tgctgctcac tagtgctaag gacagccaga tcttgtgccg gaacctgggg agcagtgagg tggtatataa gctaccaaca cagagcagct ggtgctttga tgtgcagtgg tgccctcggg acccttcagt gttctctgct gcctccttca acggctggat cagtttgtac gctgtgatgg gtaggagctg ggaagtccag cacatgagac aggctgacaa ggtttga. It is sometimes possible for the material contained within the vial of "SEC31B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
