Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SEC24A cdna clone

SEC24A cDNA Clone

Synonyms
SEC24A; SEC24A cDNA Clone; SEC24A cdna clone
Ordering
For Research Use Only!
Sequence
atgtcccagccgggaataccggcctccggcggcgccccagccagcctccaggcccagaacggagccgccttggcctcggggtctccctacaccaacggtcctgtccaaaatgcattgctgtcttcacaagagtcagtgagccaaggatacaatttccagcttccaggatcctaccctcatccaataccagcaaagactttgaatccagtctctggacagtctaactatggtggttctcagggatctgggcagactcttaatagaccacctgtggcctctaatccagtgacaccttcgcttcatagtggtcctgctccccgaatgccattacctgcttctcagaacccagctactacaccaatgccttctagtagctttcttcctgaagccaacctgccaccacctttgaattggcaatataactatccatccacagcctcacaaacaaaccattgtcctcgtgcatcatcccaaccaactgtatctggaaatacaagtttaaccacaaatcatcaatatgtttcttctggatatccttcacttcaaaatagcttcataaagtcaggtccttctgtacctcccttagtgaatccacctctgcctacaacttttcaaccaggagctcctcatgggccccctccagctggaggcccacccccagtgagggccctcacgcccctgacatcatcatatagagatgtaccccagcccttatttaattcagctgtcaaccaagaaggtattacatcaaataccaataacggatctatggtggtccacagtagttacgacgagattgaaggaggtggcttattggcaacaccacagcttactaacaagaatcccaaaatgagccgaagtgttggatattcatatccctccttaccacctggttatcagaacataacaccacctggtgcaactggagtaccaccctcttccttgaattacccaagtgggccacaagcctttactcagactcccttaggtgctaatcatttaaccacaagcatgagtggattaagtctacaaccagagggtctaagagttgtcaatcttcttcaagaaagaaacatgcttccgtcaacacctttgaagcctccagttccaaatttgcatgaagacatccagaaactcaactgtaacccagagttatttcgatgcacgctgactagcattcctcagatgcaggccttattgaataaagccaaacttcctttggggctgctgcttcatcctttcaaagacttagtgcaattgcctgtggttacctccagtacaattgtgagatgccgttcatgcaggacgtacatcaatcctttcgtcagctttcttgatcaaaggagatggaagtgtaacttatgttatcgagtcaatgatgttcctgaagaattcttgtacaaccctttgaccagagtttatggagaacctcacagaagaccagaagttcaaaatgctactattgagtttatggctccttcagaatacatgttacgaccacctcagcctccagtgtatctctttgtatttgatgtgtctcacaatgcagtcgaaactggatacttgaattcagtttgccagagtttgttagacaatctggatttgcttcctggcaacactagaacaaaaattggcttcataacatttgacagtacaatccatttctacggtcttcaggaaagtctctctcaacctcagatgctaatagtttcagatattgaagatgtttttatacctatgccagagaacttattagtaaacttaaatgaaagtaaagagagtgtcattggggtcagttcagaagaaactcttattacctgcctggaaattgccatgagataa
Sequence Length
1842
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
66,010 Da
NCBI Official Full Name
Homo sapiens SEC24 family, member A (S. cerevisiae), mRNA
NCBI Official Synonym Full Names
SEC24 homolog A, COPII coat complex component
NCBI Official Symbol
SEC24A
NCBI Protein Information
protein transport protein Sec24A
UniProt Protein Name
Protein transport protein Sec24A
Protein Family
UniProt Gene Name
SEC24A
UniProt Entry Name
SC24A_HUMAN

NCBI Description

The protein encoded by this gene belongs to a family of proteins that are homologous to yeast Sec24. This protein is a component of coat protein II (COPII)-coated vesicles that mediate protein transport from the endoplasmic reticulum. COPII acts in the cytoplasm to promote the transport of secretory, plasma membrane, and vacuolar proteins from the endoplasmic reticulum to the golgi complex. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2011]

Uniprot Description

SEC24A: Component of the COPII coat, that covers ER-derived vesicles involved in transport from the endoplasmic reticulum to the Golgi apparatus. COPII acts in the cytoplasm to promote the transport of secretory, plasma membrane, and vacuolar proteins from the endoplasmic reticulum to the Golgi complex. COPII is composed of at least five proteins: the Sec23/24 complex, the Sec13/31 complex and Sar1. SEC24A is capable of forming heterodimers with SEC24B and SEC24C. Interacts with TMED2. Expressed in fibroblasts, hepatocytes, and lymphocytes. Belongs to the SEC23/SEC24 family. SEC24 subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 5q31.1

Cellular Component: cytosol; endoplasmic reticulum membrane

Molecular Function: protein binding

Biological Process: antigen processing and presentation of exogenous peptide antigen via MHC class II; antigen processing and presentation of peptide antigen via MHC class I; COPII coating of Golgi vesicle; ER to Golgi vesicle-mediated transport

Research Articles on SEC24A

Similar Products

Product Notes

The SEC24A sec24a (Catalog #AAA1274685) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcccagc cgggaatacc ggcctccggc ggcgccccag ccagcctcca ggcccagaac ggagccgcct tggcctcggg gtctccctac accaacggtc ctgtccaaaa tgcattgctg tcttcacaag agtcagtgag ccaaggatac aatttccagc ttccaggatc ctaccctcat ccaataccag caaagacttt gaatccagtc tctggacagt ctaactatgg tggttctcag ggatctgggc agactcttaa tagaccacct gtggcctcta atccagtgac accttcgctt catagtggtc ctgctccccg aatgccatta cctgcttctc agaacccagc tactacacca atgccttcta gtagctttct tcctgaagcc aacctgccac cacctttgaa ttggcaatat aactatccat ccacagcctc acaaacaaac cattgtcctc gtgcatcatc ccaaccaact gtatctggaa atacaagttt aaccacaaat catcaatatg tttcttctgg atatccttca cttcaaaata gcttcataaa gtcaggtcct tctgtacctc ccttagtgaa tccacctctg cctacaactt ttcaaccagg agctcctcat gggccccctc cagctggagg cccaccccca gtgagggccc tcacgcccct gacatcatca tatagagatg taccccagcc cttatttaat tcagctgtca accaagaagg tattacatca aataccaata acggatctat ggtggtccac agtagttacg acgagattga aggaggtggc ttattggcaa caccacagct tactaacaag aatcccaaaa tgagccgaag tgttggatat tcatatccct ccttaccacc tggttatcag aacataacac cacctggtgc aactggagta ccaccctctt ccttgaatta cccaagtggg ccacaagcct ttactcagac tcccttaggt gctaatcatt taaccacaag catgagtgga ttaagtctac aaccagaggg tctaagagtt gtcaatcttc ttcaagaaag aaacatgctt ccgtcaacac ctttgaagcc tccagttcca aatttgcatg aagacatcca gaaactcaac tgtaacccag agttatttcg atgcacgctg actagcattc ctcagatgca ggccttattg aataaagcca aacttccttt ggggctgctg cttcatcctt tcaaagactt agtgcaattg cctgtggtta cctccagtac aattgtgaga tgccgttcat gcaggacgta catcaatcct ttcgtcagct ttcttgatca aaggagatgg aagtgtaact tatgttatcg agtcaatgat gttcctgaag aattcttgta caaccctttg accagagttt atggagaacc tcacagaaga ccagaagttc aaaatgctac tattgagttt atggctcctt cagaatacat gttacgacca cctcagcctc cagtgtatct ctttgtattt gatgtgtctc acaatgcagt cgaaactgga tacttgaatt cagtttgcca gagtttgtta gacaatctgg atttgcttcc tggcaacact agaacaaaaa ttggcttcat aacatttgac agtacaatcc atttctacgg tcttcaggaa agtctctctc aacctcagat gctaatagtt tcagatattg aagatgtttt tatacctatg ccagagaact tattagtaaa cttaaatgaa agtaaagaga gtgtcattgg ggtcagttca gaagaaactc ttattacctg cctggaaatt gccatgagat aa. It is sometimes possible for the material contained within the vial of "SEC24A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.