Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SCARB1 cdna clone

SCARB1 cDNA Clone

Gene Names
SCARB1; CLA1; SRB1; CLA-1; SR-BI; CD36L1; HDLQTL6
Synonyms
SCARB1; SCARB1 cDNA Clone; SCARB1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggctgctccgccaaagcgcgctgggctgccggggcgctgggcgtcgcggggctactgtgcgctgtgctgggcgctgtcatgatcgtgatggtgccgtcgctcatcaagcagcaggtccttaagaacgtgcgcatcgaccccagtagcctgtccttcaacatgtggaaggagatccctatccccttctatctctccgtctacttctttgacgtcatgaaccccagcgagatcctgaagggcgagaagccgcaggtgcgggagcgcgggccctacgtgtacagggagttcaggcacaaaagcaacatcaccttcaacaacaacgacaccgtgtccttcctcgagtaccgcaccttccagttccagccctccaagtcccacggctcggagagcgactacatcgtcatgcccaacatcctggtcttgggtgcggcggtgatgatggagaataagcccatgaccctgaagctcatcatgaccttggcattcaccaccctcggcgaacgtgccttcatgaaccgcactgtgggtgagatcatgtggggctacaaggacccccttgtgaatctcatcaacaagtactttccaggcatgttccccttcaaggacaagttcggattatttgctgagctcaacaactccgactctgggctcttcacggtgttcacgggggtccagaacatcagcaggatccacctcgtggacaagtggaacgggctgagcaaggttgacttctggcattccgatcagtgcaacatgatcaatggaacttctgggcaaatgtggccgcccttcatgactcctgagtcctcgctggagttctacagcccggaggcctgccgatccatgaagctaatgtacaaggagtcaggggtgtttgaaggcatccccacctatcgcttcgtggctcccaaaaccctgtttgccaacgggtccatctacccacccaacgaaggcttctgcccgtgcctggagtctggaattcagaacgtcagcacctgcaggttcagtgcccccttgtttctctcccatcctcacttcctcaacgccgacccggttctggcagaagcggtgactggcctgcaccctaaccaggaggcacactccttgttcctggacatccacccggtcacgggaatccccatgaactgctctgtgaaactgcagctgagcctctacatgaaatctgtcgcaggcattggacaaactgggaagattgagcctgtggtcctgccgctgctctggtttgcagagagcggggccatggagggggagactcttcacacattctacactcagctggtgttgatgcccaaggtgatgcactatgcccagtacgtcctcctggcgctgggctgcgtcctgctgctggtccctgtcatctgccaaatccggagccaagtaggtgctggccagagggcagcccgggctgacagccattcgcttgcctgctgggggaaaggggcctcagatcggaccctctggccaaccgcagcctggagcccacctccagcagcagtcctgcgtctctgccggagtgggagcggtcactgctgggggctgcgcagcacgcttgcgtcttttgcatgccgcgttgccactactctgcctgttctggaaggcctgggaccctcccttggagggggcacagggtcctga
Sequence Length
1659
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
949
Molecular Weight
56,170 Da
NCBI Official Full Name
Homo sapiens scavenger receptor class B, member 1, mRNA
NCBI Official Synonym Full Names
scavenger receptor class B member 1
NCBI Official Symbol
SCARB1
NCBI Official Synonym Symbols
CLA1; SRB1; CLA-1; SR-BI; CD36L1; HDLQTL6
NCBI Protein Information
scavenger receptor class B member 1
UniProt Protein Name
Scavenger receptor class B member 1
Protein Family
UniProt Gene Name
SCARB1
UniProt Synonym Gene Names
CD36L1; CLA1; SRB1; CLA-1
UniProt Entry Name
SCRB1_HUMAN

NCBI Description

The protein encoded by this gene is a plasma membrane receptor for high density lipoprotein cholesterol (HDL). The encoded protein mediates cholesterol transfer to and from HDL. In addition, this protein is a receptor for hepatitis C virus glycoprotein E2. Two transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Mar 2011]

Uniprot Description

SCARB1: Receptor for different ligands such as phospholipids, cholesterol ester, lipoproteins, phosphatidylserine and apoptotic cells. Probable receptor for HDL, located in particular region of the plasma membrane, called caveolae. Facilitates the flux of free and esterified cholesterol between the cell surface and extracellular donors and acceptors, such as HDL and to a lesser extent, apoB-containing lipoproteins and modified lipoproteins. Probably involved in the phagocytosis of apoptotic cells, via its phosphatidylserine binding activity. Receptor for hepatitis C virus glycoprotein E2. Binding between SCARB1 and E2 was found to be independent of the genotype of the viral isolate. Plays an important role in the uptake of HDL cholesteryl ester. Belongs to the CD36 family. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; Membrane protein, multi-pass; Receptor, misc.

Chromosomal Location of Human Ortholog: 12q24.31

Cellular Component: caveola; cell surface; intracellular membrane-bound organelle; lysosomal membrane; plasma membrane

Molecular Function: apolipoprotein A-I binding; apolipoprotein binding; lipopolysaccharide binding; lipopolysaccharide receptor activity; low-density lipoprotein binding; phosphatidylinositol binding; phosphatidylserine binding; protein binding; transporter activity

Biological Process: adhesion to host; cholesterol efflux; cholesterol homeostasis; detection of lipopolysaccharide; lipopolysaccharide transport; lipoprotein metabolic process; phospholipid transport; positive regulation of nitric-oxide synthase activity; receptor-mediated endocytosis; recognition of apoptotic cell; regulation of phagocytosis; reverse cholesterol transport; wound healing

Disease: High Density Lipoprotein Cholesterol Level Quantitative Trait Locus 6

Research Articles on SCARB1

Similar Products

Product Notes

The SCARB1 scarb1 (Catalog #AAA1272859) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggctgct ccgccaaagc gcgctgggct gccggggcgc tgggcgtcgc ggggctactg tgcgctgtgc tgggcgctgt catgatcgtg atggtgccgt cgctcatcaa gcagcaggtc cttaagaacg tgcgcatcga ccccagtagc ctgtccttca acatgtggaa ggagatccct atccccttct atctctccgt ctacttcttt gacgtcatga accccagcga gatcctgaag ggcgagaagc cgcaggtgcg ggagcgcggg ccctacgtgt acagggagtt caggcacaaa agcaacatca ccttcaacaa caacgacacc gtgtccttcc tcgagtaccg caccttccag ttccagccct ccaagtccca cggctcggag agcgactaca tcgtcatgcc caacatcctg gtcttgggtg cggcggtgat gatggagaat aagcccatga ccctgaagct catcatgacc ttggcattca ccaccctcgg cgaacgtgcc ttcatgaacc gcactgtggg tgagatcatg tggggctaca aggaccccct tgtgaatctc atcaacaagt actttccagg catgttcccc ttcaaggaca agttcggatt atttgctgag ctcaacaact ccgactctgg gctcttcacg gtgttcacgg gggtccagaa catcagcagg atccacctcg tggacaagtg gaacgggctg agcaaggttg acttctggca ttccgatcag tgcaacatga tcaatggaac ttctgggcaa atgtggccgc ccttcatgac tcctgagtcc tcgctggagt tctacagccc ggaggcctgc cgatccatga agctaatgta caaggagtca ggggtgtttg aaggcatccc cacctatcgc ttcgtggctc ccaaaaccct gtttgccaac gggtccatct acccacccaa cgaaggcttc tgcccgtgcc tggagtctgg aattcagaac gtcagcacct gcaggttcag tgcccccttg tttctctccc atcctcactt cctcaacgcc gacccggttc tggcagaagc ggtgactggc ctgcacccta accaggaggc acactccttg ttcctggaca tccacccggt cacgggaatc cccatgaact gctctgtgaa actgcagctg agcctctaca tgaaatctgt cgcaggcatt ggacaaactg ggaagattga gcctgtggtc ctgccgctgc tctggtttgc agagagcggg gccatggagg gggagactct tcacacattc tacactcagc tggtgttgat gcccaaggtg atgcactatg cccagtacgt cctcctggcg ctgggctgcg tcctgctgct ggtccctgtc atctgccaaa tccggagcca agtaggtgct ggccagaggg cagcccgggc tgacagccat tcgcttgcct gctgggggaa aggggcctca gatcggaccc tctggccaac cgcagcctgg agcccacctc cagcagcagt cctgcgtctc tgccggagtg ggagcggtca ctgctggggg ctgcgcagca cgcttgcgtc ttttgcatgc cgcgttgcca ctactctgcc tgttctggaa ggcctgggac cctcccttgg agggggcaca gggtcctga. It is sometimes possible for the material contained within the vial of "SCARB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.