Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SARS cdna clone

SARS cDNA Clone

Gene Names
SARS; SERS; SERRS
Synonyms
SARS; SARS cDNA Clone; SARS cdna clone
Ordering
For Research Use Only!
Sequence
atggtgctggatctggatttgtttcgggtggataaaggaggggacccagccctcatccgagagacgcaggagaagcgcttcaaggacccgggactagtggaccagctggtgaaggcagacagcgagtggcgacgatgtagatttcgggcagacaacttgaacaagctgaagaacctatgcagcaagacaatcggagagaaaatgaagaaaaaagagccagtgggagatgatgagtctgtcccagagaatgtgctgagtttcgatgaccttactgcagacgctttagctaacctgaaagtctcacaaatcaaaaaagtccgactcctcattgatgaagccatcctgaagtgtgacgcggagcggataaagttggaagcagagcggtttgagaacctccgagagattgggaaccttctgcacccttctgtacccatcagtaacgatgaggatgtggacaacaaagtagagaggatttggggtgattgtacagtcaggaagaagtactctcatgtggacctggtggtgatggtagatggctttgaaggcgaaaagggggccgtggtggctgggagtcgagggtacttcttgaagggggtcctggtgttcctggaacaggctctcatccagtatgcccttcgcaccttgggaagtcggggctacattcccatttataccccctttttcatgaggaaggaggtcatgcaggaggtggcacagctcagccagtttgatgaagaactttataaggtgattggcaaaggcagtgaaaagtctgatgacaactcctatgatgagaagtacctgattgccacctcagagcagcccattgctgccctgcaccgggatgagtggctccggccggaggacctgcccatcaagtatgctggcctgtctacctgcttccgtcaggaggtgggctcccatggccgtgacacccgtggcatcttccgagtccatcagtttgagaagattgaacagtttgtgtactcatcaccccatgacaacaagtcatgggagatgtttgaagagatgattaccaccgcagaggagttctaccagtccctggggattccttaccacattgtgaatattgtctcaggttctttgaatcatgctgccagtaagaagcttgacctggaggcctggtttccgggctcaggagccttccgtgagttggtctcctgttctaattgcacggattaccaggctcgccggcttcgaatccgatatgggcaaaccaagaagatgatggacaaggtggagtttgtccatatgctcaatgctaccatgtgcgccactacccgtaccatctgcgccatcctggagaactaccagacagagaagggcatcactgtgcctgagaaattgaaggagttcatgccgccaggactgcaagaactgatcccctttgtgaagcctgcgcccattgagcaggagccatcaaagaagcagaagaagcaacatgagggcagcaaaaagaaagcagcagcaagagacgtcaccctagaaaacaggctgcagaacatggaggtcaccgatgcttga
Sequence Length
1545
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,777 Da
NCBI Official Full Name
Homo sapiens seryl-tRNA synthetase, mRNA
NCBI Official Synonym Full Names
seryl-tRNA synthetase
NCBI Official Symbol
SARS
NCBI Official Synonym Symbols
SERS; SERRS
NCBI Protein Information
serine--tRNA ligase, cytoplasmic
UniProt Protein Name
Serine--tRNA ligase, cytoplasmic
Protein Family
UniProt Gene Name
SARS
UniProt Synonym Gene Names
SERS; SerRS
UniProt Entry Name
SYSC_HUMAN

NCBI Description

This gene belongs to the class II amino-acyl tRNA family. The encoded enzyme catalyzes the transfer of L-serine to tRNA (Ser) and is related to bacterial and yeast counterparts. Multiple alternatively spliced transcript variants have been described but the biological validity of all variants is unknown. [provided by RefSeq, Jul 2010]

Uniprot Description

SARS: Catalyzes the attachment of serine to tRNA(Ser). Is also probably able to aminoacylate tRNA(Sec) with serine, to form the misacylated tRNA L-seryl-tRNA(Sec), which will be further converted into selenocysteinyl-tRNA(Sec). Belongs to the class-II aminoacyl-tRNA synthetase family. Type-1 seryl-tRNA synthetase subfamily.

Protein type: RNA processing; Translation; EC 6.1.1.11; Ligase

Chromosomal Location of Human Ortholog: 1p13.3

Cellular Component: cytoplasm; cytosol

Molecular Function: RNA binding; serine-tRNA ligase activity

Biological Process: selenocysteine metabolic process; seryl-tRNA aminoacylation; translation; tRNA aminoacylation for protein translation; tRNA processing

Research Articles on SARS

Similar Products

Product Notes

The SARS sars (Catalog #AAA1277319) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtgctgg atctggattt gtttcgggtg gataaaggag gggacccagc cctcatccga gagacgcagg agaagcgctt caaggacccg ggactagtgg accagctggt gaaggcagac agcgagtggc gacgatgtag atttcgggca gacaacttga acaagctgaa gaacctatgc agcaagacaa tcggagagaa aatgaagaaa aaagagccag tgggagatga tgagtctgtc ccagagaatg tgctgagttt cgatgacctt actgcagacg ctttagctaa cctgaaagtc tcacaaatca aaaaagtccg actcctcatt gatgaagcca tcctgaagtg tgacgcggag cggataaagt tggaagcaga gcggtttgag aacctccgag agattgggaa ccttctgcac ccttctgtac ccatcagtaa cgatgaggat gtggacaaca aagtagagag gatttggggt gattgtacag tcaggaagaa gtactctcat gtggacctgg tggtgatggt agatggcttt gaaggcgaaa agggggccgt ggtggctggg agtcgagggt acttcttgaa gggggtcctg gtgttcctgg aacaggctct catccagtat gcccttcgca ccttgggaag tcggggctac attcccattt ataccccctt tttcatgagg aaggaggtca tgcaggaggt ggcacagctc agccagtttg atgaagaact ttataaggtg attggcaaag gcagtgaaaa gtctgatgac aactcctatg atgagaagta cctgattgcc acctcagagc agcccattgc tgccctgcac cgggatgagt ggctccggcc ggaggacctg cccatcaagt atgctggcct gtctacctgc ttccgtcagg aggtgggctc ccatggccgt gacacccgtg gcatcttccg agtccatcag tttgagaaga ttgaacagtt tgtgtactca tcaccccatg acaacaagtc atgggagatg tttgaagaga tgattaccac cgcagaggag ttctaccagt ccctggggat tccttaccac attgtgaata ttgtctcagg ttctttgaat catgctgcca gtaagaagct tgacctggag gcctggtttc cgggctcagg agccttccgt gagttggtct cctgttctaa ttgcacggat taccaggctc gccggcttcg aatccgatat gggcaaacca agaagatgat ggacaaggtg gagtttgtcc atatgctcaa tgctaccatg tgcgccacta cccgtaccat ctgcgccatc ctggagaact accagacaga gaagggcatc actgtgcctg agaaattgaa ggagttcatg ccgccaggac tgcaagaact gatccccttt gtgaagcctg cgcccattga gcaggagcca tcaaagaagc agaagaagca acatgagggc agcaaaaaga aagcagcagc aagagacgtc accctagaaa acaggctgca gaacatggag gtcaccgatg cttga. It is sometimes possible for the material contained within the vial of "SARS, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.