Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SAE1 cdna clone

SAE1 cDNA Clone

Gene Names
SAE1; AOS1; SUA1; UBLE1A; HSPC140
Synonyms
SAE1; SAE1 cDNA Clone; SAE1 cdna clone
Ordering
For Research Use Only!
Sequence
atggtggagaaggaggaggctggcggcggcattagcgaggaggaggcggcacagtatgaccggcagatccgcctgtggggactggaggcccagaaacggctgcgggcctctcgggtgcttcttgtcggcttgaaaggacttggggctgaaattgccaagaatctcatcttggcaggagtgaaaggactgaccatgctggatcacgaacaggtaactccagaagatcccggagctcagttcttgattcgtactgggtctgttggccgaaatagggctgaagcctctttggagcgagctcagaatctcaaccccatggtggatgtgaaggtggacactgaggatatagagaagaaaccagagtcatttttcactcaattcgatgctgtgtgtctgacttgctgctccagggatgtcatagttaaagttgaccagatctgtcacaaaaatagcatcaagttctttacaggagatgtttttggctaccatggatacacatttgccaatctaggagagcatgagtttgtagaggagaaaactaaagttgccaaagttagccaaggagtagaagatgggcccgacaccaagagagcaaaacttgattcttctgagacaacgatggtcaaaaagaaggtggtcttctgccctgttaaagaagccctggaggtggactggagcagtgagaaagcaaaggctgctctgaagcgcacgacctccgactactttctccttcaagtgctcttaaagttccgtacagataaaggaagagatcccagttctgatacatatgaggaagattctgagttgttgctccagatacgaaatgatgtgcttgactcactgggtattagtcctgacctgcttcctgaggactttgtcaggtactgcttctccgagatggccccagtgtgtgcggtggttggagggattttggcacaggaaattgtgaaggccctgtctcagcgggaccctcctcacaacaacttcttcttcttcgatggcatgaaggggaatgggattgtggagtgccttggccccaagtga
Sequence Length
1041
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,063 Da
NCBI Official Full Name
Homo sapiens SUMO1 activating enzyme subunit 1, mRNA
NCBI Official Synonym Full Names
SUMO1 activating enzyme subunit 1
NCBI Official Symbol
SAE1
NCBI Official Synonym Symbols
AOS1; SUA1; UBLE1A; HSPC140
NCBI Protein Information
SUMO-activating enzyme subunit 1
UniProt Protein Name
SUMO-activating enzyme subunit 1
Protein Family
UniProt Gene Name
SAE1
UniProt Synonym Gene Names
AOS1; SUA1; UBLE1A
UniProt Entry Name
SAE1_HUMAN

NCBI Description

Posttranslational modification of proteins by the addition of the small protein SUMO (see SUMO1; MIM 601912), or sumoylation, regulates protein structure and intracellular localization. SAE1 and UBA2 (MIM 613295) form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins (Okuma et al., 1999 [PubMed 9920803]).[supplied by OMIM, Mar 2010]

Uniprot Description

UBLE1A: The heterodimer acts as a E1 ligase for SUMO1, SUMO2, SUMO3, and probably SUMO4. It mediates ATP-dependent activation of SUMO proteins followed by formation of a thioester bond between a SUMO protein and a conserved active site cysteine residue on UBA2/SAE2. Belongs to the ubiquitin-activating E1 family.

Protein type: Ubiquitin ligase; EC 6.3.2.19; Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 19q13.32

Cellular Component: cytosol; nucleoplasm; nucleus

Molecular Function: ATP-dependent protein binding; enzyme activator activity; protein binding; protein C-terminus binding; protein heterodimerization activity; SUMO activating enzyme activity; ubiquitin activating enzyme activity

Biological Process: protein sumoylation; protein ubiquitination; regulation of mitotic cell cycle

Research Articles on SAE1

Similar Products

Product Notes

The SAE1 sae1 (Catalog #AAA1266350) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtggaga aggaggaggc tggcggcggc attagcgagg aggaggcggc acagtatgac cggcagatcc gcctgtgggg actggaggcc cagaaacggc tgcgggcctc tcgggtgctt cttgtcggct tgaaaggact tggggctgaa attgccaaga atctcatctt ggcaggagtg aaaggactga ccatgctgga tcacgaacag gtaactccag aagatcccgg agctcagttc ttgattcgta ctgggtctgt tggccgaaat agggctgaag cctctttgga gcgagctcag aatctcaacc ccatggtgga tgtgaaggtg gacactgagg atatagagaa gaaaccagag tcatttttca ctcaattcga tgctgtgtgt ctgacttgct gctccaggga tgtcatagtt aaagttgacc agatctgtca caaaaatagc atcaagttct ttacaggaga tgtttttggc taccatggat acacatttgc caatctagga gagcatgagt ttgtagagga gaaaactaaa gttgccaaag ttagccaagg agtagaagat gggcccgaca ccaagagagc aaaacttgat tcttctgaga caacgatggt caaaaagaag gtggtcttct gccctgttaa agaagccctg gaggtggact ggagcagtga gaaagcaaag gctgctctga agcgcacgac ctccgactac tttctccttc aagtgctctt aaagttccgt acagataaag gaagagatcc cagttctgat acatatgagg aagattctga gttgttgctc cagatacgaa atgatgtgct tgactcactg ggtattagtc ctgacctgct tcctgaggac tttgtcaggt actgcttctc cgagatggcc ccagtgtgtg cggtggttgg agggattttg gcacaggaaa ttgtgaaggc cctgtctcag cgggaccctc ctcacaacaa cttcttcttc ttcgatggca tgaaggggaa tgggattgtg gagtgccttg gccccaagtg a. It is sometimes possible for the material contained within the vial of "SAE1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.