Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RSPRY1 cdna clone

RSPRY1 cDNA Clone

Gene Names
RSPRY1; SEMDFA
Synonyms
RSPRY1; RSPRY1 cDNA Clone; RSPRY1 cdna clone
Ordering
For Research Use Only!
Sequence
atgatcgtctttggttgggccgtgttcttagcgagcagaagccttggccagggtctgttgttgactctcgaagagcacatagcccacttcctagggactggaggtgccgctactaccatgggtaattcctgtatctgccgagatgacagtggaacagatgacagtgttgacacccaacagcaacaggccgagaacagtgcagtacccactgctgacacaaggagccaaccacgggaccctgttcggccaccaaggaggggccgaggacctcatgagccaaggagaaagaaacaaaatgtggatgggctagtgttggacacactggcagtaatacggactcttgtagataatgatcaggaacctccctattcaatgataacattacacgaaatggcagaaacagatgaaggatggttggatgttgtccagtctttaattagagttattccactggaagatccactgggaccagctgttataacattgttactagatgaatgtccattgcccactaaagatgcactccagaaattgactgaaattctcaatttaaatggagaagtagcttgccaggactcaagccatcctgccaaacacaggaacacatctgcagtcctaggctgcttggccgagaaactagcaggtcctgcaagtataggtttacttagcccaggaatactggaatacttgctacagtgtctgaagttacagtcccaccccacagtcatgctttttgcacttatcgcactggaaaagtttgcacagacaagtgaaaataaattgactatttctgaatccagtattagtgaccggcttgtcacattggagtcctgggctaatgatcctgattatctgaaacgtcaagttggtttctgtgcccagtggagcttagacaatctctttttaaaagaaggtagacagctgacctatgagaaagtgaacttgagtagcattagggccatgctgaatagcaatgatgtcagcgagtacctgaagatctcacctcatggcttagaggctcgctgtgatgcctcctcttttgaaagtgtgcgttgcaccttttgtgtggatgccggggtatggtactatgaagtaacagtggtcacttctggcgtcatgcagattggctgggccactcgagacagcaaattcctcaatcatgaaggctacggcattggggatgatgaatactcctgtgcgtatgatggctgccggcagctgatttggtacaatgccagaagtaagcctcacatacacccatgctggaaagaaggagatacagtaggatttctgttagacttgaatgaaaagcaaatgatcttctttttaaatggcaaccagctgcctcctgaaaagcaagtcttttcatctactgtatctggattttttgctgcagctagtttcatgtcatatcaacaatgtgagttcaattttggagcaaaaccattcaaatacccaccatctatgaaatttagcacttttaatgactacgccttcctaacagctgaagaaaaaatcattttgccaaggcacaggcgtcttgctctgttgaagcaagtcagtatccgagaaaactgctgttccctttgttgtgatgaggtagcagacacacaattgaagccatgtggacacagtgacctgtgcatggattgtgccttgcagctggagacctgcccattgtgtcgtaaagaaatagtatctagaatcagacagatttctcatatttcatga
Sequence Length
1731
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
12,692 Da
NCBI Official Full Name
Homo sapiens ring finger and SPRY domain containing 1, mRNA
NCBI Official Synonym Full Names
ring finger and SPRY domain containing 1
NCBI Official Symbol
RSPRY1
NCBI Official Synonym Symbols
SEMDFA
NCBI Protein Information
RING finger and SPRY domain-containing protein 1
UniProt Protein Name
RING finger and SPRY domain-containing protein 1
UniProt Gene Name
RSPRY1
UniProt Synonym Gene Names
KIAA1972
UniProt Entry Name
RSPRY_HUMAN

NCBI Description

This gene encodes a glycoprotein that contains a RING-type zinc finger domain and an SPRY domain of unknown function. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]

Uniprot Description

RSPRY1: 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Secreted, signal peptide; Ubiquitin conjugating system; Secreted

Chromosomal Location of Human Ortholog: 16q13

Disease: Spondyloepimetaphyseal Dysplasia, Faden-alkuraya Type

Research Articles on RSPRY1

Similar Products

Product Notes

The RSPRY1 rspry1 (Catalog #AAA1276664) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatcgtct ttggttgggc cgtgttctta gcgagcagaa gccttggcca gggtctgttg ttgactctcg aagagcacat agcccacttc ctagggactg gaggtgccgc tactaccatg ggtaattcct gtatctgccg agatgacagt ggaacagatg acagtgttga cacccaacag caacaggccg agaacagtgc agtacccact gctgacacaa ggagccaacc acgggaccct gttcggccac caaggagggg ccgaggacct catgagccaa ggagaaagaa acaaaatgtg gatgggctag tgttggacac actggcagta atacggactc ttgtagataa tgatcaggaa cctccctatt caatgataac attacacgaa atggcagaaa cagatgaagg atggttggat gttgtccagt ctttaattag agttattcca ctggaagatc cactgggacc agctgttata acattgttac tagatgaatg tccattgccc actaaagatg cactccagaa attgactgaa attctcaatt taaatggaga agtagcttgc caggactcaa gccatcctgc caaacacagg aacacatctg cagtcctagg ctgcttggcc gagaaactag caggtcctgc aagtataggt ttacttagcc caggaatact ggaatacttg ctacagtgtc tgaagttaca gtcccacccc acagtcatgc tttttgcact tatcgcactg gaaaagtttg cacagacaag tgaaaataaa ttgactattt ctgaatccag tattagtgac cggcttgtca cattggagtc ctgggctaat gatcctgatt atctgaaacg tcaagttggt ttctgtgccc agtggagctt agacaatctc tttttaaaag aaggtagaca gctgacctat gagaaagtga acttgagtag cattagggcc atgctgaata gcaatgatgt cagcgagtac ctgaagatct cacctcatgg cttagaggct cgctgtgatg cctcctcttt tgaaagtgtg cgttgcacct tttgtgtgga tgccggggta tggtactatg aagtaacagt ggtcacttct ggcgtcatgc agattggctg ggccactcga gacagcaaat tcctcaatca tgaaggctac ggcattgggg atgatgaata ctcctgtgcg tatgatggct gccggcagct gatttggtac aatgccagaa gtaagcctca catacaccca tgctggaaag aaggagatac agtaggattt ctgttagact tgaatgaaaa gcaaatgatc ttctttttaa atggcaacca gctgcctcct gaaaagcaag tcttttcatc tactgtatct ggattttttg ctgcagctag tttcatgtca tatcaacaat gtgagttcaa ttttggagca aaaccattca aatacccacc atctatgaaa tttagcactt ttaatgacta cgccttccta acagctgaag aaaaaatcat tttgccaagg cacaggcgtc ttgctctgtt gaagcaagtc agtatccgag aaaactgctg ttccctttgt tgtgatgagg tagcagacac acaattgaag ccatgtggac acagtgacct gtgcatggat tgtgccttgc agctggagac ctgcccattg tgtcgtaaag aaatagtatc tagaatcaga cagatttctc atatttcatg a. It is sometimes possible for the material contained within the vial of "RSPRY1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.