Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RSAD2 cdna clone

RSAD2 cDNA Clone

Synonyms
RSAD2; RSAD2 cDNA Clone; RSAD2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtgggtgcttacacctgctgcttttgctgggaagctcttgagtgtgttcaggcaacctctgagctctctgtggaggagcctggtcccgctgttctgctggctgagggcaaccttctggctgcgagctaccaagaggagaaagcagcagctggtcctgagagggccagatgagaccaaagaggaggaagaggaccctcctctgcccaccaccccaaccagcgtcaactatcacttcactcgccagtgcaactacaaatgcggcttctgtttccacacagccaaaacatcctttgtgctgccccttgaggaagcaaagagaggattgcttttgcttaaggaagctggtatggagaagatcaacttttcaggtggagagccatttcttcaagaccggggagaatacctgggcaagttggtgaggttctgcaaagtagagttgcggctgcccagcgtgagcatcgtgagcaatggaagcctgatccgggagaggtggttccagaattatggtgagtatttggacattctcgctatctcctgtgacagctttgacgaggaagtcaatgtccttattggccgtggccaaggaaagaagaaccatgtggaaaaccttcaaaagctgaggaggtggtgtagggattatagagtcgctttcaagataaattctgtcattaatcgtttcaacgtggaagaggacatgacggaacagatcaaagcactaaaccctgtccgctggaaagtgttccagtgcctcttaattgagggtgagaattgtggagaagatgctctaagagaagcagaaagatttgttattggtgatgaagaatttgaaagattcttggagcgccacaaagaagtgtcctgcttggtgcctgaatctaaccagaagatgaaagactcctaccttattctggatgaatatatgcgctttctgaactgtagaaagggacggaaggacccttccaagtccatcctggatgttggtgtagaagaagctataaaattcagtggatttgatgaaaagatgtttctgaagcgaggaggaaaatacatatggagtaaggctgatctgaagctggattggtag
Sequence Length
1086
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,170 Da
NCBI Official Full Name
Homo sapiens radical S-adenosyl methionine domain containing 2, mRNA
UniProt Protein Name
Radical S-adenosyl methionine domain-containing protein 2
UniProt Gene Name
RSAD2
UniProt Entry Name
RSAD2_HUMAN

Uniprot Description

RSAD2: Interferon-inducible iron-sulfur (4FE-4S) cluster- binding antiviral protein which plays a major role in the cell antiviral state induced by type I and type II interferon. Can inhibit a wide range of DNA and RNA viruses, including human cytomegalovirus (HCMV), hepatitis C virus (HCV), west Nile virus (WNV), dengue virus, sindbis virus, influenza A virus, sendai virus, vesicular stomatitis virus (VSV), and human immunodeficiency virus (HIV-1). Displays antiviral activity against influenza A virus by inhibiting the budding of the virus from the plasma membrane by disturbing the lipid rafts. This is accomplished, at least in part, through binding and inhibition of the enzyme farnesyl diphospate synthase (FPPS), which is essential for the biosynthesis of isoprenoid-derived lipids. Promotes TLR7 and TLR9-dependent production of IFN-beta production in plasmacytoid dendritic cells (pDCs) by facilitating Lys-63'-linked ubiquitination of IRAK1. Plays a role in CD4+ T-cells activation and differentiation. Facilitates T-cell receptor (TCR)-mediated GATA3 activation and optimal T helper 2 (Th2) cytokine production by modulating NFKB1 and JUNB activities. Can inhibit secretion of soluble proteins. Belongs to the radical SAM superfamily. RSAD2 family.

Chromosomal Location of Human Ortholog: 2p25.2

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; lipid particle; mitochondrial inner membrane; mitochondrial outer membrane; mitochondrion

Molecular Function: 4 iron, 4 sulfur cluster binding; protein binding; protein self-association

Biological Process: CD4-positive, alpha beta T cell differentiation; defense response to virus; negative regulation of protein secretion; negative regulation of viral genome replication; positive regulation of toll-like receptor 7 signaling pathway; positive regulation of toll-like receptor 9 signaling pathway; response to virus

Similar Products

Product Notes

The RSAD2 rsad2 (Catalog #AAA1272254) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgggtgc ttacacctgc tgcttttgct gggaagctct tgagtgtgtt caggcaacct ctgagctctc tgtggaggag cctggtcccg ctgttctgct ggctgagggc aaccttctgg ctgcgagcta ccaagaggag aaagcagcag ctggtcctga gagggccaga tgagaccaaa gaggaggaag aggaccctcc tctgcccacc accccaacca gcgtcaacta tcacttcact cgccagtgca actacaaatg cggcttctgt ttccacacag ccaaaacatc ctttgtgctg ccccttgagg aagcaaagag aggattgctt ttgcttaagg aagctggtat ggagaagatc aacttttcag gtggagagcc atttcttcaa gaccggggag aatacctggg caagttggtg aggttctgca aagtagagtt gcggctgccc agcgtgagca tcgtgagcaa tggaagcctg atccgggaga ggtggttcca gaattatggt gagtatttgg acattctcgc tatctcctgt gacagctttg acgaggaagt caatgtcctt attggccgtg gccaaggaaa gaagaaccat gtggaaaacc ttcaaaagct gaggaggtgg tgtagggatt atagagtcgc tttcaagata aattctgtca ttaatcgttt caacgtggaa gaggacatga cggaacagat caaagcacta aaccctgtcc gctggaaagt gttccagtgc ctcttaattg agggtgagaa ttgtggagaa gatgctctaa gagaagcaga aagatttgtt attggtgatg aagaatttga aagattcttg gagcgccaca aagaagtgtc ctgcttggtg cctgaatcta accagaagat gaaagactcc taccttattc tggatgaata tatgcgcttt ctgaactgta gaaagggacg gaaggaccct tccaagtcca tcctggatgt tggtgtagaa gaagctataa aattcagtgg atttgatgaa aagatgtttc tgaagcgagg aggaaaatac atatggagta aggctgatct gaagctggat tggtag. It is sometimes possible for the material contained within the vial of "RSAD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.