RPP40 cdna clone
RPP40 cDNA Clone
Gene Names
RPP40; RNASEP1; bA428J1.3
Synonyms
RPP40; RPP40 cDNA Clone; RPP40 cdna clone
Sequence
atgaacactggaccctattactttgtgaagaatttacctcttcatgaattaattacacctgaattcatcagtacctttataaagaaagggaaattaattttgtcactggataaagacacttatgaagaaactggacttcagggtcatccatctcagttttctggcagaaaaattatgaaatttattgtttccattgatttgatggaattatccttaaacttggattctaagaagtatgaaagaatatcttggtctttcaaagaaaagaagccattgaaatttgattttcttttggcctggcataaaacaggttcagaagaatcgacaatgatgtcatatttttccaagtaccaaattcaggagcatcagccaaaagtagcactgagcacgttgagagatctccagtgcccagtgctgcagagcagcgagctggagggaacgccagaggtgtcctgccgggctctggagctcttcgactggctcggcgccgtcttcagtaatgtcgacctaaataatgagcctaataatttcatatcaacctattgctgtcctgagccaagcacagtggtggcaaaagcttatttgtgtacaatcactggcttcatacttccagagaagatctgtctcctattggaacatctctgtcactactttgatgaaccgaagttagctccatgggttacactgtccgttcaaggctttgcagacagccctgtttcttgggaaaaaaaatga
Sequence Length
735
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
39,327 Da
NCBI Official Full Name
Homo sapiens ribonuclease P/MRP 40kDa subunit, mRNA
NCBI Official Synonym Full Names
ribonuclease P/MRP subunit p40
NCBI Official Symbol
RPP40
NCBI Official Synonym Symbols
RNASEP1; bA428J1.3
NCBI Protein Information
ribonuclease P protein subunit p40
UniProt Protein Name
Ribonuclease P protein subunit p40
Protein Family
UniProt Gene Name
RPP40
UniProt Synonym Gene Names
RNASEP1; RNaseP protein p40
UniProt Entry Name
RPP40_HUMAN
Uniprot Description
RPP40: Component of ribonuclease P, a protein complex that generates mature tRNA molecules by cleaving their 5'-ends. 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Ribonuclease; Nucleolus; EC 3.1.26.5
Chromosomal Location of Human Ortholog: 6p25.1
Cellular Component: nucleolar ribonuclease P complex; nucleoplasm; nucleus
Biological Process: rRNA processing; tRNA 5'-leader removal
Research Articles on RPP40
Similar Products
Product Notes
The RPP40 rpp40 (Catalog #AAA1266939) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacactg gaccctatta ctttgtgaag aatttacctc ttcatgaatt aattacacct gaattcatca gtacctttat aaagaaaggg aaattaattt tgtcactgga taaagacact tatgaagaaa ctggacttca gggtcatcca tctcagtttt ctggcagaaa aattatgaaa tttattgttt ccattgattt gatggaatta tccttaaact tggattctaa gaagtatgaa agaatatctt ggtctttcaa agaaaagaag ccattgaaat ttgattttct tttggcctgg cataaaacag gttcagaaga atcgacaatg atgtcatatt tttccaagta ccaaattcag gagcatcagc caaaagtagc actgagcacg ttgagagatc tccagtgccc agtgctgcag agcagcgagc tggagggaac gccagaggtg tcctgccggg ctctggagct cttcgactgg ctcggcgccg tcttcagtaa tgtcgaccta aataatgagc ctaataattt catatcaacc tattgctgtc ctgagccaag cacagtggtg gcaaaagctt atttgtgtac aatcactggc ttcatacttc cagagaagat ctgtctccta ttggaacatc tctgtcacta ctttgatgaa ccgaagttag ctccatgggt tacactgtcc gttcaaggct ttgcagacag ccctgtttct tgggaaaaaa aatga. It is sometimes possible for the material contained within the vial of "RPP40, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
