RNPC3 cdna clone

RNPC3 cDNA Clone

Cat. Num. AAA1276064

• Gene Names: RNPC3; RNP; RBM40; SNRNP65
• Synonyms: RNPC3; RNPC3 cDNA Clone; RNPC3 cdna clone

• Sequence: atgaacaaattaatggaactagcaaatcttcagcccaaaagacctaaaacaataaagcagcgccatgtgagaaaaaagagaaaaataaaggatatgttgaatacacctttgtgtccttcacacagcagtttacatccagtgctgttaccttcagatgtatttgaccaaccacaacctgtaggtaacaaaagaattgaattccatatatctaccgacatgccagctgcatttaagaaagatttagaaaaggaacaaaattgtgaggaaaaaaatcatgatttacctgctactgaagttgatgcatccaatataggatttggaaaaatcttccccaaacctaatttggacatcacagaggagattaaagaagactctgatgaaatgccttcagaatgtatttctagaagggaattggaaaagggcagaatttctagagaagaaatggaaacactttcagttttcagaagttatgaaccgggtgaaccaaactgtagaatttatgtaaagaatttagctaaacatgttcaagaaaaggaccttaaatatatttttggaagatatgttgacttttcatcagaaacacagcggatcatgtttgatatacgtttgatgaaagaaggtcgtatgaaaggacaagctttcattggacttcctaatgaaaaagcagcagcaaaagccttaaaggaagctaatggatatgtgctttttggaaaacccatggtggttcagtttgctcgatctgctagaccaaaacaagatcctaaggaaggaaaaagaaagtgttaa
• Sequence Length: 786

• Vector: pENTR223.1 or pUC
• Clone Sequence Report: Provided with product shipment

NCBI and Uniprot Product Information

• NCBI GI #: 14715065
• NCBI GeneID: 55599
• Molecular Weight: 58,488 Da
• NCBI Official Full Name: Homo sapiens RNA-binding region (RNP1, RRM) containing 3, mRNA
• NCBI Official Synonym Full Names: RNA binding region (RNP1, RRM) containing 3
• NCBI Official Symbol: RNPC3
• NCBI Official Synonym Symbols: RNP; RBM40; SNRNP65
• NCBI Protein Information: RNA-binding protein 40
• UniProt Protein Name: RNA-binding protein 40
• Protein Family: RNA-binding protein
• UniProt Gene Name: RNPC3
• UniProt Synonym Gene Names: KIAA1839; RBM40; RNP; U11/U12 snRNP 65 kDa protein; U11/U12-65K
• UniProt Entry Name: RBM40_HUMAN

NCBI Description

Two types of spliceosomes catalyze splicing of pre-mRNAs. The major U2-type spliceosome is found in all eukaryotes and removes U2-type introns, which represent more than 99% of pre-mRNA introns. The minor U12-type spliceosome is found in some eukaryotes and removes U12-type introns, which are rare and have distinct splice consensus signals. The U12-type spliceosome consists of several small nuclear RNAs and associated proteins. This gene encodes a 65K protein that is a component of the U12-type spliceosome. This protein contains two RNA recognition motifs (RRMs), suggesting that it may contact one of the small nuclear RNAs of the minor spliceosome. [provided by RefSeq, Jul 2008]

Uniprot Description

RNPC3: Participates in pre-mRNA U12-dependent splicing, performed by the minor spliceosome which removes U12-type introns. U12-type introns comprises less than 1% of all non-coding sequences. Binds to the 3'-stem-loop of m(7)G-capped U12 snRNA.

Protein type: RNA splicing

Chromosomal Location of Human Ortholog: 1p21

Cellular Component: nucleoplasm; nucleus; U12-dependent spliceosome

Molecular Function: U12 snRNA binding

Biological Process: developmental process; nuclear mRNA splicing, via spliceosome; RNA splicing