Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF19B cdna clone

RNF19B cDNA Clone

Gene Names
RNF19B; NKLAM; IBRDC3
Synonyms
RNF19B; RNF19B cDNA Clone; RNF19B cdna clone
Ordering
For Research Use Only!
Sequence
atgcacaagtacgaggagttcatgctgcgccgctacctagcctcggaccccgactgccgctggtgcccggccccggactgcggttatgctgttattgcctatggctgtgccagctgcccgaagctaacttgtgagagggaaggttgccagactgagttctgctaccactgcaagcagatatggcatccaaatcagacatgcgatatggcccgtcaacagagggcccagactttacgagttcggaccaaacacacttcaggtctcagttatgggcaagaatctggaccagcagatgacatcaagccatgcccacgatgcagtgcatacattatcaagatgaatgatggaagctgtaatcacatgacctgtgcagtgtgtggctgtgaattctgttggctttgtatgaaagagatctcagacttgcattacctcagcccctctggctgtacattctggggcaagaagccatggagccgtaagaagaaaattctttggcagctgggcacgttgattggtgctccagtggggatttctctcattgctggcattgccattcctgccatggtcattggcattcctgtttatgttggaaggaagattcacagcaggtatgagggaaggaaaacctccaaacacaagaggaatttggctatcactggaggagtgactttgtcggtcattgcatccccagttattgctgcagttagtgttggtattggtgtccccattatgctggcatatgtttatggggttgtgcccatttctctttgtcgtggaggcggctgtggagttagcacagccaacggaaaaggagtgaaaattgaatttgatgaagatgatggtccaatcacagtggcagatgcctggagagccctcaagaatcccagcattggggaaagcagcattgaaggcctgactagtgtattgagcactagtggaagccctacagatggacttagtgttatgcaaggtccttacagcgaaacggccagctttgcagccctctcagggggcacgctgagtggcggcattctctccagtggcaagggaaaatatagcaggttagaagttcaagccgatgtccaaaaggaaattttccccaaagacacagccagtcttggtgcaattagtgacaacgcaagcactcgtgctatggccggttccataatcagttcctacaacccacaggacagagaatgcaacaatatggaaatccaagtggacattgaagccaaaccaagccactatcagctggtgagtggaagcagcacggaggactcgctccatgttcatgctcagatggcagagaatgaagaagaaggtagtggtggcggaggcagtgaagaggatcccccctgcagacaccaaagctgtgaacagaaagactgcctggccagcaaaccttgggacatcagcctggcccagcctgaaagcatccgcagtgacctagagagttctgatgcacagtcagacgatgtgccagacatcacctcagatgagtgtggctccccccgctcccatactgcagcctgcccctcgacccccagagcccaaggtgcaccgagcccaagtgcccatatgaacctctctgccctagccgagggacaaactgtcttgaagccagaaggtggagaagccagagtatga
Sequence Length
1647
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
77,854 Da
NCBI Official Full Name
Homo sapiens ring finger protein 19B, mRNA
NCBI Official Synonym Full Names
ring finger protein 19B
NCBI Official Symbol
RNF19B
NCBI Official Synonym Symbols
NKLAM; IBRDC3
NCBI Protein Information
E3 ubiquitin-protein ligase RNF19B
UniProt Protein Name
E3 ubiquitin-protein ligase RNF19B
UniProt Gene Name
RNF19B
UniProt Synonym Gene Names
IBRDC3; NKLAM
UniProt Entry Name
RN19B_HUMAN

NCBI Description

This gene encodes a multi-pass membrane protein containing two RING-type and one IBR-type zinc finger motifs. The encoded protin is an E3 ubiquitin-protein ligase that plays a role in the cytotoxic effects of natural killer (NK) cells. Alternative splicing results in multiple transcript variants. There are pseudogenes for this gene on chromosomes X and Y in a possible pseudoautosomal region. [provided by RefSeq, Jul 2014]

Uniprot Description

RNF19B: E3 ubiquitin-protein ligase which accepts ubiquitin from E2 ubiquitin-conjugating enzymes UBE2L3 and UBE2L6 in the form of a thioester and then directly transfers the ubiquitin to targeted substrates, such as UCKL1. Involved in the cytolytic activity of natural killer cells and cytotoxic T-cells. Belongs to the RBR family. RNF19 subfamily. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: EC 6.3.2.-; EC 6.3.2.19; Ligase; Membrane protein, integral; Membrane protein, multi-pass; Ubiquitin conjugating system; Ubiquitin ligase

Chromosomal Location of Human Ortholog: 1p35.1

Cellular Component: cytoplasm; cytosol; ubiquitin ligase complex

Molecular Function: protein binding; ubiquitin conjugating enzyme binding; ubiquitin-protein ligase activity

Biological Process: positive regulation of proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process

Similar Products

Product Notes

The RNF19B rnf19b (Catalog #AAA1269137) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcacaagt acgaggagtt catgctgcgc cgctacctag cctcggaccc cgactgccgc tggtgcccgg ccccggactg cggttatgct gttattgcct atggctgtgc cagctgcccg aagctaactt gtgagaggga aggttgccag actgagttct gctaccactg caagcagata tggcatccaa atcagacatg cgatatggcc cgtcaacaga gggcccagac tttacgagtt cggaccaaac acacttcagg tctcagttat gggcaagaat ctggaccagc agatgacatc aagccatgcc cacgatgcag tgcatacatt atcaagatga atgatggaag ctgtaatcac atgacctgtg cagtgtgtgg ctgtgaattc tgttggcttt gtatgaaaga gatctcagac ttgcattacc tcagcccctc tggctgtaca ttctggggca agaagccatg gagccgtaag aagaaaattc tttggcagct gggcacgttg attggtgctc cagtggggat ttctctcatt gctggcattg ccattcctgc catggtcatt ggcattcctg tttatgttgg aaggaagatt cacagcaggt atgagggaag gaaaacctcc aaacacaaga ggaatttggc tatcactgga ggagtgactt tgtcggtcat tgcatcccca gttattgctg cagttagtgt tggtattggt gtccccatta tgctggcata tgtttatggg gttgtgccca tttctctttg tcgtggaggc ggctgtggag ttagcacagc caacggaaaa ggagtgaaaa ttgaatttga tgaagatgat ggtccaatca cagtggcaga tgcctggaga gccctcaaga atcccagcat tggggaaagc agcattgaag gcctgactag tgtattgagc actagtggaa gccctacaga tggacttagt gttatgcaag gtccttacag cgaaacggcc agctttgcag ccctctcagg gggcacgctg agtggcggca ttctctccag tggcaaggga aaatatagca ggttagaagt tcaagccgat gtccaaaagg aaattttccc caaagacaca gccagtcttg gtgcaattag tgacaacgca agcactcgtg ctatggccgg ttccataatc agttcctaca acccacagga cagagaatgc aacaatatgg aaatccaagt ggacattgaa gccaaaccaa gccactatca gctggtgagt ggaagcagca cggaggactc gctccatgtt catgctcaga tggcagagaa tgaagaagaa ggtagtggtg gcggaggcag tgaagaggat cccccctgca gacaccaaag ctgtgaacag aaagactgcc tggccagcaa accttgggac atcagcctgg cccagcctga aagcatccgc agtgacctag agagttctga tgcacagtca gacgatgtgc cagacatcac ctcagatgag tgtggctccc cccgctccca tactgcagcc tgcccctcga cccccagagc ccaaggtgca ccgagcccaa gtgcccatat gaacctctct gccctagccg agggacaaac tgtcttgaag ccagaaggtg gagaagccag agtatga. It is sometimes possible for the material contained within the vial of "RNF19B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.