Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF144B cdna clone

RNF144B cDNA Clone

Gene Names
RNF144B; PIR2; IBRDC2; p53RFP; bA528A10.3
Synonyms
RNF144B; RNF144B cDNA Clone; RNF144B cdna clone
Ordering
For Research Use Only!
Sequence
atgggctcagctggtaggctccactatctcgccatgactgctgaaaatcccactcctggagacctggctccggcccccctcatcacttgcaaactctgcctgtgtgagcagtctctggacaagatgaccacactccaggaatgccagtgcatcttttgcacagcttgcctgaaacagtacatgcagctggcaatccgagaaggatgtgggtctcccatcacttgccctgacatggtgtgcctaaaccacgggaccctgcaggaagctgagattgcctgtttggtacctgtggaccagtttcaactttatcagaggttaaaatttgaaagagaagttcatctggacccctaccgaacatggtgtcctgttgcagactgtcagacagtgtgccctgttgcctcgagtgacccaggacagcctgtgctggtggaatgcccttcttgccacctgaaattctgctcgtgttgcaaggatgcttggcatgcagaggtctcctgtagagacagtcagcctattgtcctgccaacagagcaccgagccctctttgggacagatgcagaagcccccattaagcagtgcccagtttgccgggtttatatcgaacgcaatgaaggctgcgctcagatgatgtgcaaaaactgcaagcatacattttgctggtactgccttcagaacttggataatgacattttcctcagacattatgacaaagggccatgcaggaataaacttggccactcaagagcatcagtgatgtggaaccgaacacaggtggtggggattctcgtaggcttgggcatcattgccttggttacttcccccttactcctggcctccccatgtataatctgttgtgtctgcaagtcctgtcggggcaagaagaaaaagcacgacccatccacaacctaa
Sequence Length
909
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
23,856 Da
NCBI Official Full Name
Homo sapiens ring finger protein 144B, mRNA
NCBI Official Synonym Full Names
ring finger protein 144B
NCBI Official Symbol
RNF144B
NCBI Official Synonym Symbols
PIR2; IBRDC2; p53RFP; bA528A10.3
NCBI Protein Information
E3 ubiquitin-protein ligase RNF144B
UniProt Protein Name
E3 ubiquitin-protein ligase RNF144B
UniProt Gene Name
RNF144B
UniProt Synonym Gene Names
IBRDC2; P53RFP
UniProt Entry Name
R144B_HUMAN

Uniprot Description

RNF144B: E3 ubiquitin-protein ligase which accepts ubiquitin from E2 ubiquitin-conjugating enzymes UBE2L3 and UBE2L6 in the form of a thioester and then directly transfers the ubiquitin to targeted substrates such as LCMT2, thereby promoting their degradation. Induces apoptosis via a p53/TP53-dependent but caspase-independent mechanism. However, its overexpression also produces a decrease of the ubiquitin-dependent stability of BAX, a pro-apoptotic protein, ultimately leading to protection of cell death; But, it is not an anti-apoptotic protein per se. Belongs to the RBR family. RNF144 subfamily.

Protein type: Ubiquitin conjugating system; Ligase; Membrane protein, integral; EC 6.3.2.-; EC 6.3.2.19; Ubiquitin ligase

Chromosomal Location of Human Ortholog: 6p22.3

Cellular Component: cytoplasm; cytosol; mitochondrial membrane; ubiquitin ligase complex

Molecular Function: protein binding; ubiquitin conjugating enzyme binding; ubiquitin-protein ligase activity

Biological Process: positive regulation of proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process

Research Articles on RNF144B

Similar Products

Product Notes

The RNF144B rnf144b (Catalog #AAA1274042) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggctcag ctggtaggct ccactatctc gccatgactg ctgaaaatcc cactcctgga gacctggctc cggcccccct catcacttgc aaactctgcc tgtgtgagca gtctctggac aagatgacca cactccagga atgccagtgc atcttttgca cagcttgcct gaaacagtac atgcagctgg caatccgaga aggatgtggg tctcccatca cttgccctga catggtgtgc ctaaaccacg ggaccctgca ggaagctgag attgcctgtt tggtacctgt ggaccagttt caactttatc agaggttaaa atttgaaaga gaagttcatc tggaccccta ccgaacatgg tgtcctgttg cagactgtca gacagtgtgc cctgttgcct cgagtgaccc aggacagcct gtgctggtgg aatgcccttc ttgccacctg aaattctgct cgtgttgcaa ggatgcttgg catgcagagg tctcctgtag agacagtcag cctattgtcc tgccaacaga gcaccgagcc ctctttggga cagatgcaga agcccccatt aagcagtgcc cagtttgccg ggtttatatc gaacgcaatg aaggctgcgc tcagatgatg tgcaaaaact gcaagcatac attttgctgg tactgccttc agaacttgga taatgacatt ttcctcagac attatgacaa agggccatgc aggaataaac ttggccactc aagagcatca gtgatgtgga accgaacaca ggtggtgggg attctcgtag gcttgggcat cattgccttg gttacttccc ccttactcct ggcctcccca tgtataatct gttgtgtctg caagtcctgt cggggcaaga agaaaaagca cgacccatcc acaacctaa. It is sometimes possible for the material contained within the vial of "RNF144B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.