Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF14 cdna clone

RNF14 cDNA Clone

Gene Names
RNF14; ARA54; HFB30; TRIAD2; HRIHFB2038
Synonyms
RNF14; RNF14 cDNA Clone; RNF14 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcgtcagaagatcgagaagctcaggaggatgaattgctggccctggcaagtatttacgatggagatgaatttagaaaagcagagtctgtccaaggtggagaaaccaggatctatttggatttgccacagaatttcaagatatttgtgagcggcaattcaaatgagtgtctccagaatagtggctttgaatacaccatttgctttctgcctccacttgtgctgaactttgaactgccaccagattatccatcctcttccccaccttcattcacacttagtggcaaatggctgtcaccaactcagctatctgctctatgcaagcacttagacaacctatgggaagaacaccgtggcagcgtggtcctgtttgcctggatgcaatttcttaaggaagagaccctagcatacttgaatattgtctctccttttgagctcaagattggttctcagaaaaaagtgcagagaaggacagctcaagcttctcccaacacagagctagattttggaggagctgctggatctgatgtagaccaagaggaaattgtggatgagagagcagtgcaggatgtggaatcactgtcaaatctgatccaggaaatcttggactttgatcaagctcagcagataaaatgctttaatagtaaattgttcctgtgcagtatctgtttctgtgagaagctgggtagtgaatgcatgtacttcttggagtgcaggcatgtgtactgcaaagcctgtctgaaggactactttgaaatccagatcagagatggccaggttcaatgcctcaactgcccagaaccaaagtgcccttcggtggccactcctggtcaggtcaaagagttagtggaagcagagttatttgcccgttatgaccgccttctcctccagtcctccttggacctgatggcagatgtggtgtactgcccccggccgtgctgccagctgcctgtgatgcaggaacctggctgcaccatgggtatctgctccagctgcaattttgccttctgtactttgtgcaggttgacctaccatggggtctccccatgtaaggtgactgcagagaaattaatggacttacgaaatgaatacctgcaagcggatgaggctaataaaagacttttggatcaaaggtatggtaagagagtgattcagaaggcactggaagagatggaaagtaaggagtggctagagaagaactcaaagagctgcccatgttgtggaactcccatagagaaattagacggatgtaacaagatgacatgtactggctgtatgcaatatttctgttggatttgcatgggttctctctctagagcaaacccttacaaacatttcaatgaccctggttcaccatgttttaaccggctgttttatgctgtggatgttgacgacgatatttgggaagatgaggtagaagactag
Sequence Length
1425
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
39,634 Da
NCBI Official Full Name
Homo sapiens ring finger protein 14, mRNA
NCBI Official Synonym Full Names
ring finger protein 14
NCBI Official Symbol
RNF14
NCBI Official Synonym Symbols
ARA54; HFB30; TRIAD2; HRIHFB2038
NCBI Protein Information
E3 ubiquitin-protein ligase RNF14
UniProt Protein Name
E3 ubiquitin-protein ligase RNF14
UniProt Gene Name
RNF14
UniProt Synonym Gene Names
ARA54
UniProt Entry Name
RNF14_HUMAN

NCBI Description

The protein encoded by this gene contains a RING zinc finger, a motif known to be involved in protein-protein interactions. This protein interacts with androgen receptor (AR) and may function as a coactivator that induces AR target gene expression in prostate. A dominant negative mutant of this gene has been demonstrated to inhibit the AR-mediated growth of prostate cancer. This protein also interacts with class III ubiquitin-conjugating enzymes (E2s) and may act as a ubiquitin-ligase (E3) in the ubiquitination of certain nuclear proteins. Six alternatively spliced transcript variants encoding two distinct isoforms have been reported. [provided by RefSeq, Jan 2011]

Uniprot Description

RNF14: Might act as an E3 ubiquitin-protein ligase which accepts ubiquitin from specific E2 ubiquitin-conjugating enzymes and then transfers it to substrates, which could be nuclear proteins. Could play a role as a coactivator for androgen- and, to a lesser extent, progesterone-dependent transcription. Belongs to the RBR family. RNF14 subfamily.

Protein type: EC 6.3.2.19; EC 6.3.2.-; Nuclear receptor co-regulator; Ligase; Ubiquitin ligase; Ubiquitin conjugating system; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 5q23.3-q31.1

Cellular Component: cytoplasm; nucleus; ubiquitin ligase complex

Molecular Function: androgen receptor binding; protein binding; small conjugating protein ligase activity; transcription coactivator activity; ubiquitin conjugating enzyme binding

Biological Process: positive regulation of proteasomal ubiquitin-dependent protein catabolic process; positive regulation of transcription, DNA-dependent; protein polyubiquitination; protein ubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process; regulation of transcription from RNA polymerase II promoter; regulation of transcription, DNA-dependent; signal transduction

Research Articles on RNF14

Similar Products

Product Notes

The RNF14 rnf14 (Catalog #AAA1273551) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcgtcag aagatcgaga agctcaggag gatgaattgc tggccctggc aagtatttac gatggagatg aatttagaaa agcagagtct gtccaaggtg gagaaaccag gatctatttg gatttgccac agaatttcaa gatatttgtg agcggcaatt caaatgagtg tctccagaat agtggctttg aatacaccat ttgctttctg cctccacttg tgctgaactt tgaactgcca ccagattatc catcctcttc cccaccttca ttcacactta gtggcaaatg gctgtcacca actcagctat ctgctctatg caagcactta gacaacctat gggaagaaca ccgtggcagc gtggtcctgt ttgcctggat gcaatttctt aaggaagaga ccctagcata cttgaatatt gtctctcctt ttgagctcaa gattggttct cagaaaaaag tgcagagaag gacagctcaa gcttctccca acacagagct agattttgga ggagctgctg gatctgatgt agaccaagag gaaattgtgg atgagagagc agtgcaggat gtggaatcac tgtcaaatct gatccaggaa atcttggact ttgatcaagc tcagcagata aaatgcttta atagtaaatt gttcctgtgc agtatctgtt tctgtgagaa gctgggtagt gaatgcatgt acttcttgga gtgcaggcat gtgtactgca aagcctgtct gaaggactac tttgaaatcc agatcagaga tggccaggtt caatgcctca actgcccaga accaaagtgc ccttcggtgg ccactcctgg tcaggtcaaa gagttagtgg aagcagagtt atttgcccgt tatgaccgcc ttctcctcca gtcctccttg gacctgatgg cagatgtggt gtactgcccc cggccgtgct gccagctgcc tgtgatgcag gaacctggct gcaccatggg tatctgctcc agctgcaatt ttgccttctg tactttgtgc aggttgacct accatggggt ctccccatgt aaggtgactg cagagaaatt aatggactta cgaaatgaat acctgcaagc ggatgaggct aataaaagac ttttggatca aaggtatggt aagagagtga ttcagaaggc actggaagag atggaaagta aggagtggct agagaagaac tcaaagagct gcccatgttg tggaactccc atagagaaat tagacggatg taacaagatg acatgtactg gctgtatgca atatttctgt tggatttgca tgggttctct ctctagagca aacccttaca aacatttcaa tgaccctggt tcaccatgtt ttaaccggct gttttatgct gtggatgttg acgacgatat ttgggaagat gaggtagaag actag. It is sometimes possible for the material contained within the vial of "RNF14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.