Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RNF125 cdna clone

RNF125 cDNA Clone

Gene Names
RNF125; TNORS; TRAC1; TRAC-1
Synonyms
RNF125; RNF125 cDNA Clone; RNF125 cdna clone
Ordering
For Research Use Only!
Sequence
atgggctccgtgctgagcaccgacagcggcaaatcggcgcccgcctctgccaccgcgcgggccctggagcgcaggagggacccggagttgcccgtcacgtccttcgactgcgccgtgtgccttgaggtgttacaccagcctgtccggacccgctgtggccacgtattctgccgttcctgtattgctaccagtctaaagaacaacaagtggacctgtccttattgccgggcatatcttccttcagaaggagttccagcaactgatgtagccaaaagaatgaaatcagagtataagaactgcgctgagtgtgacatagttctttacctcagtgaaatgagggcacatattcggacttgtcagaagtacatagataagtatggaccactacaagaacttgaggagacagcagcaaggtgtgtatgtcccttttgtcagagggaactgtatgaagacagcttgctggatcattgtattactcatcacagatcggaacggaggcctgtgttctgtccactttgccgtttaatacccgatgagaatccaagcagcttcagtggcagtttaataagacatctgcaagttagtcacactttgttttatgatgatttcatagattttaatataattgaggaagctcttatccgaagagtcttagaccggtcacttcttgaatatgtgaatcactcgaacacagcataa
Sequence Length
699
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
26,454 Da
NCBI Official Full Name
Homo sapiens ring finger protein 125, mRNA
NCBI Official Synonym Full Names
ring finger protein 125
NCBI Official Symbol
RNF125
NCBI Official Synonym Symbols
TNORS; TRAC1; TRAC-1
NCBI Protein Information
E3 ubiquitin-protein ligase RNF125
UniProt Protein Name
E3 ubiquitin-protein ligase RNF125
UniProt Gene Name
RNF125
UniProt Synonym Gene Names
TRAC-1
UniProt Entry Name
RN125_HUMAN

NCBI Description

This gene encodes a novel E3 ubiquitin ligase that contains a RING finger domain in the N-terminus and three zinc-binding and one ubiquitin-interacting motif in the C-terminus. As a result of myristoylation, this protein associates with membranes and is primarily localized to intracellular membrane systems. The encoded protein may function as a positive regulator in the T-cell receptor signaling pathway. [provided by RefSeq, Mar 2012]

Uniprot Description

RNF125: E3 ubiquitin-protein ligase that acts as a positive regulator of T-cell activation. E3 ligase proteins mediate ubiquitination and subsequent proteasomal degradation of target proteins.

Protein type: Ligase; EC 6.3.2.19; Ubiquitin ligase; Ubiquitin conjugating system; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 18q12.1

Cellular Component: Golgi membrane; intracellular; intracellular membrane-bound organelle

Molecular Function: ubiquitin conjugating enzyme binding

Biological Process: positive regulation of proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination

Disease: Tenorio Syndrome

Research Articles on RNF125

Similar Products

Product Notes

The RNF125 rnf125 (Catalog #AAA1267095) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggctccg tgctgagcac cgacagcggc aaatcggcgc ccgcctctgc caccgcgcgg gccctggagc gcaggaggga cccggagttg cccgtcacgt ccttcgactg cgccgtgtgc cttgaggtgt tacaccagcc tgtccggacc cgctgtggcc acgtattctg ccgttcctgt attgctacca gtctaaagaa caacaagtgg acctgtcctt attgccgggc atatcttcct tcagaaggag ttccagcaac tgatgtagcc aaaagaatga aatcagagta taagaactgc gctgagtgtg acatagttct ttacctcagt gaaatgaggg cacatattcg gacttgtcag aagtacatag ataagtatgg accactacaa gaacttgagg agacagcagc aaggtgtgta tgtccctttt gtcagaggga actgtatgaa gacagcttgc tggatcattg tattactcat cacagatcgg aacggaggcc tgtgttctgt ccactttgcc gtttaatacc cgatgagaat ccaagcagct tcagtggcag tttaataaga catctgcaag ttagtcacac tttgttttat gatgatttca tagattttaa tataattgag gaagctctta tccgaagagt cttagaccgg tcacttcttg aatatgtgaa tcactcgaac acagcataa. It is sometimes possible for the material contained within the vial of "RNF125, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.