RNF112 cdna clone
RNF112 cDNA Clone
Gene Names
RNF112; BFP; ZNF179
Synonyms
RNF112; RNF112 cDNA Clone; RNF112 cdna clone
Sequence
atgccaaggcccgccttgtcagtcacttccttttgtcatcggcttggcaaacgggagagaaaacagagcttcatgggaaacagcggcaacagttggtcccatacacctttccccaagttggagctaggcctggggccccagcccatggcgccccgggagctccctacctgctccatctgcctggagaggttgcgcgaccccatctcgctggactgtggccacgacttctgcatacggtgcttcagcacacaccgtctcccgggctgtgagccgccctgctgtcctgagtgccggaagatatgcaagcagaagaggggcctccggagcctgggcgagaagatgaagctcctgccgcagcggccgctgccccctgcactgcaggagacgtgtcctgtgagggcggagccgctgctgctggttcgcatcaatgcctctgggggcctcatccttaggatgggggccatcaaccgctgcctgaagcaccctctggccagggacaccccagtctgcctcctcgctgtcctgggggagcagcactcagggaagtccttcctcctcaaccatttgcttcagggcttgccgggcctggagtctggtgagggcggccggccaagaggaggagaggcatccctgcagggctgcaggtggggcgccaatggcctcgccaggggcatatggatgtggagccaccccttcttgctggggaaagaagggaagaaggtggcggtgttcctggtggacacaggggatgccatgagccctgagctgagcagggaaacaaggatcaagctctgtgctctcaccacgatgctgagctcctaccagatcctcagcacctcccaggagctgaaggatacagacctggactatctggagatgtttgtccacgtggccgaggtgatgggcaagcattatgggatggtgccaatccagcatctggacctcttagttcgtgactcatcccaccccaacaaggcagggcaggggcatgtaggcaacatcttccagagattgtctggcagataccccaaggtgcaggagctgctgcaagggaagcgagcccgttgctgcctcttgcctgccccagggaggcggcggatgaaccaaggccatgcaagccctggtgacacagatgatgacttccgccaccttctgggggcctacgtctcagatgtgctgagtgcggccccccagcacgctaagagccgctgccaggggtactggaacgaggggcgcgccgtggccaggggggacagacgcctactcacggggcagcagctagctcaggaaatcaagaacctctcaggatggatggggaggacagggcccggtttcacctctccggatgagatggctgctcagctgcacgacctgaggaaggtggaagctgccaagagggagttcgaggagtatgtgaggcagcaggacgtagccaccaagcgcatattctctgcgctgcgggtcctgccagacaccatgcggaacctcctctccacccagaaagatgccattctggcccgccatggtgtggccttactctgcaaggggagagatcagaccttggaggcactggaagctgagctgcaggccacggccaaggccttcatggactcctacacgatgcgcttctgtggccacctagctgctgtggggggtgctgtgggggccgggctcatgggcctggcagggggcgtggtgggtgctggcatggcagcagctgcactggctgcagaggctgggatggtggctgctggagctgccgtgggggccacaggggccgctgtggttgggggtggcgtgggtgctgggttggctgccacagtgggctgcatggagaaggaggaggatgagaggcttctggaaggggaccgagagccccttctccaggaagagtaa
Sequence Length
1896
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
68,355 Da
NCBI Official Full Name
Homo sapiens ring finger protein 112, mRNA
NCBI Official Synonym Full Names
ring finger protein 112
NCBI Official Symbol
RNF112
NCBI Official Synonym Symbols
BFP; ZNF179
NCBI Protein Information
RING finger protein 112
UniProt Protein Name
RING finger protein 112
Protein Family
UniProt Gene Name
RNF112
UniProt Synonym Gene Names
BFP; ZNF179
UniProt Entry Name
RN112_HUMAN
NCBI Description
This gene encodes a member of the RING finger protein family of transcription factors. The protein is primarily expressed in brain. The gene is located within the Smith-Magenis syndrome region on chromosome 17. [provided by RefSeq, Jul 2008]
Uniprot Description
RNF112: 2 isoforms of the human protein are produced by alternative splicing.
Protein type: Membrane protein, multi-pass; Hydrolase; Ubiquitin conjugating system
Chromosomal Location of Human Ortholog: 17p11.2
Research Articles on RNF112
Similar Products
Product Notes
The RNF112 rnf112 (Catalog #AAA1274930) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgccaaggc ccgccttgtc agtcacttcc ttttgtcatc ggcttggcaa acgggagaga aaacagagct tcatgggaaa cagcggcaac agttggtccc atacaccttt ccccaagttg gagctaggcc tggggcccca gcccatggcg ccccgggagc tccctacctg ctccatctgc ctggagaggt tgcgcgaccc catctcgctg gactgtggcc acgacttctg catacggtgc ttcagcacac accgtctccc gggctgtgag ccgccctgct gtcctgagtg ccggaagata tgcaagcaga agaggggcct ccggagcctg ggcgagaaga tgaagctcct gccgcagcgg ccgctgcccc ctgcactgca ggagacgtgt cctgtgaggg cggagccgct gctgctggtt cgcatcaatg cctctggggg cctcatcctt aggatggggg ccatcaaccg ctgcctgaag caccctctgg ccagggacac cccagtctgc ctcctcgctg tcctggggga gcagcactca gggaagtcct tcctcctcaa ccatttgctt cagggcttgc cgggcctgga gtctggtgag ggcggccggc caagaggagg agaggcatcc ctgcagggct gcaggtgggg cgccaatggc ctcgccaggg gcatatggat gtggagccac cccttcttgc tggggaaaga agggaagaag gtggcggtgt tcctggtgga cacaggggat gccatgagcc ctgagctgag cagggaaaca aggatcaagc tctgtgctct caccacgatg ctgagctcct accagatcct cagcacctcc caggagctga aggatacaga cctggactat ctggagatgt ttgtccacgt ggccgaggtg atgggcaagc attatgggat ggtgccaatc cagcatctgg acctcttagt tcgtgactca tcccacccca acaaggcagg gcaggggcat gtaggcaaca tcttccagag attgtctggc agatacccca aggtgcagga gctgctgcaa gggaagcgag cccgttgctg cctcttgcct gccccaggga ggcggcggat gaaccaaggc catgcaagcc ctggtgacac agatgatgac ttccgccacc ttctgggggc ctacgtctca gatgtgctga gtgcggcccc ccagcacgct aagagccgct gccaggggta ctggaacgag gggcgcgccg tggccagggg ggacagacgc ctactcacgg ggcagcagct agctcaggaa atcaagaacc tctcaggatg gatggggagg acagggcccg gtttcacctc tccggatgag atggctgctc agctgcacga cctgaggaag gtggaagctg ccaagaggga gttcgaggag tatgtgaggc agcaggacgt agccaccaag cgcatattct ctgcgctgcg ggtcctgcca gacaccatgc ggaacctcct ctccacccag aaagatgcca ttctggcccg ccatggtgtg gccttactct gcaaggggag agatcagacc ttggaggcac tggaagctga gctgcaggcc acggccaagg ccttcatgga ctcctacacg atgcgcttct gtggccacct agctgctgtg gggggtgctg tgggggccgg gctcatgggc ctggcagggg gcgtggtggg tgctggcatg gcagcagctg cactggctgc agaggctggg atggtggctg ctggagctgc cgtgggggcc acaggggccg ctgtggttgg gggtggcgtg ggtgctgggt tggctgccac agtgggctgc atggagaagg aggaggatga gaggcttctg gaaggggacc gagagcccct tctccaggaa gagtaa. It is sometimes possible for the material contained within the vial of "RNF112, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
