Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RIPK2 cdna clone

RIPK2 cDNA Clone

Gene Names
RIPK2; CCK; RICK; RIP2; CARD3; GIG30; CARDIAK
Synonyms
RIPK2; RIPK2 cDNA Clone; RIPK2 cdna clone
Ordering
For Research Use Only!
Sequence
atgaacggggaggccatctgcagcgccctgcccaccattccctaccacaaactcgccgacctgcgctacctgagccgcggcgcctctggcactgtgtcgtccgcccgccacgcagactggcgcgtccaggtggccgtgaagcacctgcacatccacactccgctgctcgacagtgaaagaaaggatgtcttaagagaagctgaaattttacacaaagctagatttagttacattcttccaattttgggaatttgcaatgagcctgaatttttgggaatagttactgaatacatgccaaatggatcattaaatgaactcctacataggaaaactgaatatcctgatgttgcttggccattgagatttcgcatcctgcatgaaattgcccttggtgtaaattacctgcacaatatgactcctcctttacttcatcatgacttgaagactcagaatatcttattggacaatgaatttcatgttaagattgcagattttggtttatcaaagtggcgcatgatgtccctctcacagtcacgaagtagcaaatctgcaccagaaggagggacaattatctatatgccacctgaaaactatgaacctggacaaaaatcaagggccagtatcaagcacgatatatatagctatgcagttatcacatgggaagtgttatccagaaaacagccttttgaagatgtcaccaatcctttgcagataatgtatagtgtgtcacaaggacatcgacctgttattaatgaagaaagtttgccatatgatatacctcaccgagcacgtatgatctctctaatagaaagtggatgggcacaaaatccagatgaaagaccatctttcttaaaatgtttaatagaacttgaaccagttttgagaacatttgaagagataacttttcttgaagctgttattcagctaaagaaaacaaagttacagagtgtttcaagtgccattcacctatgtgacaagaagaaaatggaattatctctgaacatacctgtaaatcatggtccacaagaggaatcatgtggatcctctcagctccatgaaaatagtggttctcctgaaacttcaaggtccctgccagctcctcaagacaatgattttttatctagaaaagctcaagactgttattttatgaagctgcatcactgtcctggaaatcacagttgggatagcaccatttctggatctcaaagggctgcattctgtgatcacaagaccactccatgctcttcagcaataataaatccactctcaactgcaggaaactcagaacgtctgcagcctggtatagcccagcagtggatccagagcaaaagggaagacattgtgaaccaaatgacagaagcctgccttaaccagtcgctagatgcccttctgtccagggacttgatcatgaaagaggactatgaacttgttagtaccaagcctacaaggacctcaaaagtcagacaattactagacactactgacatccaaggagaagaatttgccaaagttatagtacaaaaattgaaagataacaaacaaatgggtcttcagccttacccggaaatacttgtggtttctagatcaccatctttaaatttacttcaaaataaaagcatgtaa
Sequence Length
1623
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,582 Da
NCBI Official Full Name
Homo sapiens receptor-interacting serine-threonine kinase 2, mRNA
NCBI Official Synonym Full Names
receptor interacting serine/threonine kinase 2
NCBI Official Symbol
RIPK2
NCBI Official Synonym Symbols
CCK; RICK; RIP2; CARD3; GIG30; CARDIAK
NCBI Protein Information
receptor-interacting serine/threonine-protein kinase 2
UniProt Protein Name
Receptor-interacting serine/threonine-protein kinase 2
UniProt Gene Name
RIPK2
UniProt Synonym Gene Names
CARDIAK; RICK; RIP2; CARD-containing IL-1 beta ICE-kinase; RIP-2
UniProt Entry Name
RIPK2_HUMAN

NCBI Description

This gene encodes a member of the receptor-interacting protein (RIP) family of serine/threonine protein kinases. The encoded protein contains a C-terminal caspase activation and recruitment domain (CARD), and is a component of signaling complexes in both the innate and adaptive immune pathways. It is a potent activator of NF-kappaB and inducer of apoptosis in response to various stimuli. [provided by RefSeq, Jul 2008]

Uniprot Description

RIPK2: a tyrosine kinase-like kinase of the RIPK family. Activates pro-caspase-1 and pro-caspase-8. Potentiates casp-8-mediated apoptosis. May activate NF-kappaB.

Protein type: Protein kinase, Ser/Thr (non-receptor); Kinase, protein; EC 2.7.10.2; EC 2.7.11.1; Protein kinase, TKL; TKL group; RIPK family

Chromosomal Location of Human Ortholog: 8q21

Cellular Component: cytoplasm; cytoskeleton; cytosol; protein complex; vesicle

Molecular Function: CARD domain binding; LIM domain binding; protein binding; protein homodimerization activity; protein serine/threonine kinase activity; receptor binding; signal transducer activity

Biological Process: activation of MAPK activity; activation of NF-kappaB transcription factor; adaptive immune response; I-kappaB kinase/NF-kappaB cascade; inflammatory response; innate immune response; JNK cascade; negative regulation of apoptosis; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of peptidyl-serine phosphorylation; positive regulation of peptidyl-tyrosine phosphorylation; positive regulation of protein ubiquitination; signal transduction; T cell receptor signaling pathway; toll-like receptor 2 signaling pathway

Research Articles on RIPK2

Similar Products

Product Notes

The RIPK2 ripk2 (Catalog #AAA1267882) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaacgggg aggccatctg cagcgccctg cccaccattc cctaccacaa actcgccgac ctgcgctacc tgagccgcgg cgcctctggc actgtgtcgt ccgcccgcca cgcagactgg cgcgtccagg tggccgtgaa gcacctgcac atccacactc cgctgctcga cagtgaaaga aaggatgtct taagagaagc tgaaatttta cacaaagcta gatttagtta cattcttcca attttgggaa tttgcaatga gcctgaattt ttgggaatag ttactgaata catgccaaat ggatcattaa atgaactcct acataggaaa actgaatatc ctgatgttgc ttggccattg agatttcgca tcctgcatga aattgccctt ggtgtaaatt acctgcacaa tatgactcct cctttacttc atcatgactt gaagactcag aatatcttat tggacaatga atttcatgtt aagattgcag attttggttt atcaaagtgg cgcatgatgt ccctctcaca gtcacgaagt agcaaatctg caccagaagg agggacaatt atctatatgc cacctgaaaa ctatgaacct ggacaaaaat caagggccag tatcaagcac gatatatata gctatgcagt tatcacatgg gaagtgttat ccagaaaaca gccttttgaa gatgtcacca atcctttgca gataatgtat agtgtgtcac aaggacatcg acctgttatt aatgaagaaa gtttgccata tgatatacct caccgagcac gtatgatctc tctaatagaa agtggatggg cacaaaatcc agatgaaaga ccatctttct taaaatgttt aatagaactt gaaccagttt tgagaacatt tgaagagata acttttcttg aagctgttat tcagctaaag aaaacaaagt tacagagtgt ttcaagtgcc attcacctat gtgacaagaa gaaaatggaa ttatctctga acatacctgt aaatcatggt ccacaagagg aatcatgtgg atcctctcag ctccatgaaa atagtggttc tcctgaaact tcaaggtccc tgccagctcc tcaagacaat gattttttat ctagaaaagc tcaagactgt tattttatga agctgcatca ctgtcctgga aatcacagtt gggatagcac catttctgga tctcaaaggg ctgcattctg tgatcacaag accactccat gctcttcagc aataataaat ccactctcaa ctgcaggaaa ctcagaacgt ctgcagcctg gtatagccca gcagtggatc cagagcaaaa gggaagacat tgtgaaccaa atgacagaag cctgccttaa ccagtcgcta gatgcccttc tgtccaggga cttgatcatg aaagaggact atgaacttgt tagtaccaag cctacaagga cctcaaaagt cagacaatta ctagacacta ctgacatcca aggagaagaa tttgccaaag ttatagtaca aaaattgaaa gataacaaac aaatgggtct tcagccttac ccggaaatac ttgtggtttc tagatcacca tctttaaatt tacttcaaaa taaaagcatg taa. It is sometimes possible for the material contained within the vial of "RIPK2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.