Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RIPK1 cdna clone

RIPK1 cDNA Clone

Gene Names
RIPK1; RIP; RIP1; RIP-1
Synonyms
RIPK1; RIPK1 cDNA Clone; RIPK1 cdna clone
Ordering
For Research Use Only!
Sequence
atgcaaccagacatgtccttgaatgtcattaagatgaaatccagtgacttcctggagagtgcagaactggacagcggaggcttcgggaaggtgtctctgtgtttccacagaacccagggactcatgatcatgaaaacagtgtacaaggggcccaactgcattgagcacaacgaggccctcttggaggaggcgaagatgatgaacagactgagacacagccgggtggtgaagctcctgggcgtcatcatagaggaagggaagtactccctggtgatggagtacatggagaagggcaacctgatgcacgtgctgaaagccgagatgagtactccgctttctgtaaaaggaaggataattttggaaatcattgaaggaatgtgctacttacatggaaaaggcgtgatacacaaggacctgaagcctgaaaatatccttgttgataatgacttccacattaagatcgcagacctcggccttgcctcctttaagatgtggagcaaactgaataatgaagagcacaatgagctgagggaagtggacggcaccgctaagaagaatggcggcaccctctactacatggcgcccgagcacctgaatgacgtcaacgcaaagcccacagagaagtcggatgtgtacagctttgctgtagtactctgggcgatatttgcaaataaggagccatatgaaaatgctatctgtgagcagcagttgataatgtgcataaaatctgggaacaggccagatgtggatgacatcactgagtactgcccaagagaaattatcagtctcatgaagctctgctgggaagcgaatccggaagctcggccgacatttcctggcattgaagaaaaatttaggcctttttatttaagtcaattagaagaaagtgtagaagaggacgtgaagagtttaaagaaagagtattcaaacgaaaatgcagttgtgaagagaatgcagtctcttcaacttgattgtgtggcagtaccttcaagccggtcaaattcagccacagaacagcctggttcactgcacagttcccagggacttgggatgggtcctgtggaggagtcctggtttgctccttccctggagcacccacaagaagagaatgagcccagcctgcagagtaaactccaagacgaagccaactaccatctttatggcagccgcatggacaggcagacgaaacagcagcccagacagaatgtggcttacaacagagaggaggaaaggagacgcagggtctcccatgacccttttgcacagcaaagaccttacgagaattttcagaatacagagggaaaaggcactgcttattccagtgcagccagtcatggtaatgcagtgcaccagccctcagggctcaccagccaacctcaagtactgtatcagaacaatggattatatagctcacatggctttggaacaagaccactggatccaggaacagcaggtcccagagtttggtacaggccaattccaagtcatatgcctagtctgcataatatcccagtgcctgagaccaactatctaggaaatacacccaccatgccattcagctccttgccaccaacagatgaatctataaaatataccatatacaatagtactggcattcagattggagcctacaattatatggagattggtgggacgagttcatcactactagacagcacaaatacgaacttcaaagaagagccagctgctaagtaccaagctatctttgataataccactagtctgacggataaacacctggacccaatcagggaaaatctgggaaagcactggaaaaactgtgcccgtaaactgggcttcacacagtctcagattgatgaaattgaccatgactatgagcgagatggactgaaagaaaaggtttaccagatgctccaaaagtgggtgatgagggaaggcataaagggagccacggtggggaagctggcccaggcgctccaccagtgttccaggatcgaccttctgagcagcttgatttacgtcagccagaactaa
Sequence Length
2016
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
70,733 Da
NCBI Official Full Name
Homo sapiens receptor (TNFRSF)-interacting serine-threonine kinase 1, mRNA
NCBI Official Synonym Full Names
receptor interacting serine/threonine kinase 1
NCBI Official Symbol
RIPK1
NCBI Official Synonym Symbols
RIP; RIP1; RIP-1
NCBI Protein Information
receptor-interacting serine/threonine-protein kinase 1
UniProt Protein Name
Receptor-interacting serine/threonine-protein kinase 1
UniProt Gene Name
RIPK1
UniProt Synonym Gene Names
RIP; RIP1; RIP-1
UniProt Entry Name
RIPK1_HUMAN

Uniprot Description

RIPK1: Serine-threonine kinase which transduces inflammatory and cell-death signals (necroptosis) following death receptors ligation, activation of pathogen recognition receptors (PRRs), and DNA damage. Upon activation of TNFR1 by the TNF-alpha family cytokines, TRADD and TRAF2 are recruited to the receptor. Ubiquitination by TRAF2 via 'Lys-63'-link chains acts as a critical enhancer of communication with downstream signal transducers in the mitogen-activated protein kinase pathway and the NF-kappa-B pathway, which in turn mediate downstream events including the activation of genes encoding inflammatory molecules. Polyubiquitinated protein binds to IKBKG/NEMO, the regulatory subunit of the IKK complex, a critical event for NF-kappa-B activation. Interaction with other cellular RHIM-containing adapters initiates gene activation and cell death. RIPK1 and RIPK3 association, in particular, forms a necroptosis-inducing complex. Interacts (via RIP homotypic interaction motif) with RIPK3 (via RIP homotypic interaction motif); this interaction induces RIPK1 necroptosis-specific phosphorylation, formation of the necroptosis-inducing complex. Interacts (via the death domain) with TNFRSF6 (via the death domain) and TRADD (via the death domain). Is recruited by TRADD to TNFRSF1A in a TNF-dependent process. Binds RNF216, EGFR, IKBKG, TRAF1, TRAF2 and TRAF3. Interacts with BNLF1. Interacts with SQSTM1 upon TNF-alpha stimulation. May interact with MAVS/IPS1. Interacts with ZFAND5. Interacts with RBCK1. Interacts with BIRC2/c-IAP1, BIRC3/c-IAP2 and XIAP/BIRC4. Inhibited by necrostatin-1. Belongs to the protein kinase superfamily. TKL Ser/Thr protein kinase family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Kinase, protein; Protein kinase, TKL; Protein kinase, Ser/Thr (non-receptor); EC 2.7.11.1; TKL group; RIPK family

Chromosomal Location of Human Ortholog: 6p25.2

Cellular Component: cytoplasm; cytosol; mitochondrion; receptor complex

Molecular Function: death receptor binding; identical protein binding; protein binding; protein complex binding; protein kinase activity; protein serine/threonine kinase activity; ubiquitin protein ligase binding

Biological Process: activation of JNK activity; activation of NF-kappaB transcription factor; apoptosis; caspase activation; cellular protein catabolic process; I-kappaB kinase/NF-kappaB cascade; negative regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of apoptosis; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of interleukin-8 production; positive regulation of JNK cascade; positive regulation of macrophage differentiation; positive regulation of programmed cell death; positive regulation of protein amino acid phosphorylation; positive regulation of transcription from RNA polymerase II promoter; positive regulation of tumor necrosis factor production; protein amino acid autophosphorylation; protein heterooligomerization; protein homooligomerization; tumor necrosis factor-mediated signaling pathway

Research Articles on RIPK1

Similar Products

Product Notes

The RIPK1 ripk1 (Catalog #AAA1270903) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcaaccag acatgtcctt gaatgtcatt aagatgaaat ccagtgactt cctggagagt gcagaactgg acagcggagg cttcgggaag gtgtctctgt gtttccacag aacccaggga ctcatgatca tgaaaacagt gtacaagggg cccaactgca ttgagcacaa cgaggccctc ttggaggagg cgaagatgat gaacagactg agacacagcc gggtggtgaa gctcctgggc gtcatcatag aggaagggaa gtactccctg gtgatggagt acatggagaa gggcaacctg atgcacgtgc tgaaagccga gatgagtact ccgctttctg taaaaggaag gataattttg gaaatcattg aaggaatgtg ctacttacat ggaaaaggcg tgatacacaa ggacctgaag cctgaaaata tccttgttga taatgacttc cacattaaga tcgcagacct cggccttgcc tcctttaaga tgtggagcaa actgaataat gaagagcaca atgagctgag ggaagtggac ggcaccgcta agaagaatgg cggcaccctc tactacatgg cgcccgagca cctgaatgac gtcaacgcaa agcccacaga gaagtcggat gtgtacagct ttgctgtagt actctgggcg atatttgcaa ataaggagcc atatgaaaat gctatctgtg agcagcagtt gataatgtgc ataaaatctg ggaacaggcc agatgtggat gacatcactg agtactgccc aagagaaatt atcagtctca tgaagctctg ctgggaagcg aatccggaag ctcggccgac atttcctggc attgaagaaa aatttaggcc tttttattta agtcaattag aagaaagtgt agaagaggac gtgaagagtt taaagaaaga gtattcaaac gaaaatgcag ttgtgaagag aatgcagtct cttcaacttg attgtgtggc agtaccttca agccggtcaa attcagccac agaacagcct ggttcactgc acagttccca gggacttggg atgggtcctg tggaggagtc ctggtttgct ccttccctgg agcacccaca agaagagaat gagcccagcc tgcagagtaa actccaagac gaagccaact accatcttta tggcagccgc atggacaggc agacgaaaca gcagcccaga cagaatgtgg cttacaacag agaggaggaa aggagacgca gggtctccca tgaccctttt gcacagcaaa gaccttacga gaattttcag aatacagagg gaaaaggcac tgcttattcc agtgcagcca gtcatggtaa tgcagtgcac cagccctcag ggctcaccag ccaacctcaa gtactgtatc agaacaatgg attatatagc tcacatggct ttggaacaag accactggat ccaggaacag caggtcccag agtttggtac aggccaattc caagtcatat gcctagtctg cataatatcc cagtgcctga gaccaactat ctaggaaata cacccaccat gccattcagc tccttgccac caacagatga atctataaaa tataccatat acaatagtac tggcattcag attggagcct acaattatat ggagattggt gggacgagtt catcactact agacagcaca aatacgaact tcaaagaaga gccagctgct aagtaccaag ctatctttga taataccact agtctgacgg ataaacacct ggacccaatc agggaaaatc tgggaaagca ctggaaaaac tgtgcccgta aactgggctt cacacagtct cagattgatg aaattgacca tgactatgag cgagatggac tgaaagaaaa ggtttaccag atgctccaaa agtgggtgat gagggaaggc ataaagggag ccacggtggg gaagctggcc caggcgctcc accagtgttc caggatcgac cttctgagca gcttgattta cgtcagccag aactaa. It is sometimes possible for the material contained within the vial of "RIPK1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.