Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RIMS3 cdna clone

RIMS3 cDNA Clone

Gene Names
RIMS3; NIM3; RIM3
Synonyms
RIMS3; RIMS3 cDNA Clone; RIMS3 cdna clone
Ordering
For Research Use Only!
Sequence
atgtttaacggggagccaggtcctgcctcatctggggcctccaggaatgtggtgcggagctccagcattagcggtgaaatctgcggatcccagcaagccgggggcggggctgggaccaccaccgccaagaagcggcggagcagcctgggtgccaagatggtggccatcgtgggcctgactcagtggagcaagagcacactccagcttccgcagcctgaaggggccaccaagaagctgcgcagcaacatccgccggagcacggagacaggcatcgcggtggagatgcggagccgggtcacacgccagggcagccgggagtccaccgatgggagcaccaacagcaacagctccgacggcacgttcatcttccccactacccggctaggggctgaaagccagttcagcgatttcctggatgggctgggaccagctcagattgtggggcgacagacactggcaacaccacccatgggagatgtgcacattgccatcatggaccggagtggccagctggaggtggaagtgattgaagctcggggcctgacccccaaaccaggctccaaatccctcccagccacctatatcaaggtttacctgctggagaatggggcctgcttggccaagaagaagacaaagatgaccaagaagacctgtgatcccctgtaccagcaggctctgctctttgacgagggaccccagggcaaggtgctgcaggtgatcgtctggggagactatggccgcatggaccacaagtgcttcatgggcatggcccagatcatgctggacgagctggacctcagcgccgcggtcaccggctggtacaaactcttccccacctcctcagtggcagactccacactcggatccctcaccaggcgcctgtcccagtcttccctggagagtgccaccagcccctcatgctcttaa
Sequence Length
927
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
15,898 Da
NCBI Official Full Name
Homo sapiens regulating synaptic membrane exocytosis 3, mRNA
NCBI Official Synonym Full Names
regulating synaptic membrane exocytosis 3
NCBI Official Symbol
RIMS3
NCBI Official Synonym Symbols
NIM3; RIM3
NCBI Protein Information
regulating synaptic membrane exocytosis protein 3
UniProt Protein Name
Regulating synaptic membrane exocytosis protein 3
UniProt Gene Name
RIMS3
UniProt Synonym Gene Names
KIAA0237; Nim3; RIM 3
UniProt Entry Name
RIMS3_HUMAN

Uniprot Description

RIMS3: Regulates synaptic membrane exocytosis.

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 1p34.2

Cellular Component: presynaptic active zone

Biological Process: calcium ion-dependent exocytosis; regulation of membrane potential

Research Articles on RIMS3

Similar Products

Product Notes

The RIMS3 rims3 (Catalog #AAA1266127) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttaacg gggagccagg tcctgcctca tctggggcct ccaggaatgt ggtgcggagc tccagcatta gcggtgaaat ctgcggatcc cagcaagccg ggggcggggc tgggaccacc accgccaaga agcggcggag cagcctgggt gccaagatgg tggccatcgt gggcctgact cagtggagca agagcacact ccagcttccg cagcctgaag gggccaccaa gaagctgcgc agcaacatcc gccggagcac ggagacaggc atcgcggtgg agatgcggag ccgggtcaca cgccagggca gccgggagtc caccgatggg agcaccaaca gcaacagctc cgacggcacg ttcatcttcc ccactacccg gctaggggct gaaagccagt tcagcgattt cctggatggg ctgggaccag ctcagattgt ggggcgacag acactggcaa caccacccat gggagatgtg cacattgcca tcatggaccg gagtggccag ctggaggtgg aagtgattga agctcggggc ctgaccccca aaccaggctc caaatccctc ccagccacct atatcaaggt ttacctgctg gagaatgggg cctgcttggc caagaagaag acaaagatga ccaagaagac ctgtgatccc ctgtaccagc aggctctgct ctttgacgag ggaccccagg gcaaggtgct gcaggtgatc gtctggggag actatggccg catggaccac aagtgcttca tgggcatggc ccagatcatg ctggacgagc tggacctcag cgccgcggtc accggctggt acaaactctt ccccacctcc tcagtggcag actccacact cggatccctc accaggcgcc tgtcccagtc ttccctggag agtgccacca gcccctcatg ctcttaa. It is sometimes possible for the material contained within the vial of "RIMS3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.