Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RHOA cdna clone

RHOA cDNA Clone

Gene Names
RHOA; ARHA; ARH12; RHO12; RHOH12
Synonyms
RHOA; RHOA cDNA Clone; RHOA cdna clone
Ordering
For Research Use Only!
Sequence
atggctgccatccggaagaaactggtgattgttggtgatggagcctgtggaaagacatgcttgctcatagtcttcagcaaggaccagttcccagaggtgtatgtgcccacagtgtttgagaactatgtggcagatatcgaggtggatggaaagcaggtagaattggctttgtgggacacagctgggcaggaagattatgatcgcctgaggcccctctcctacccagataccgatgttatactgatgtgtttttccatcgacagccctgatagtttagaaaacatcccagaaaagtggaccccagaagtcaagcatttctgtcccaacgtgcccatcatcctggttgggaataagaaggatcttcggaatgatgagcacacaaggcgggagctagccaagatgaagcaggagccggtgaaacctgaagaaggcagagatatggcaaacaggattggcgcttttgggtacatggagtgttcagcaaagaccaaagatggagtgagagaggtttttgaaatggctacgagagctgctctgcaagctagacgtgggaagaaaaaatctgggtgccttgtcttgtga
Sequence Length
582
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
387
Molecular Weight
21,768 Da
NCBI Official Full Name
Homo sapiens ras homolog gene family, member A, mRNA
NCBI Official Synonym Full Names
ras homolog family member A
NCBI Official Symbol
RHOA
NCBI Official Synonym Symbols
ARHA; ARH12; RHO12; RHOH12
NCBI Protein Information
transforming protein RhoA
UniProt Protein Name
Transforming protein RhoA
Protein Family
UniProt Gene Name
RHOA
UniProt Synonym Gene Names
ARH12; ARHA; RHO12; h12
UniProt Entry Name
RHOA_HUMAN

NCBI Description

This gene encodes a member of the Rho family of small GTPases, which cycle between inactive GDP-bound and active GTP-bound states and function as molecular switches in signal transduction cascades. Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. Overexpression of this gene is associated with tumor cell proliferation and metastasis. Multiple alternatively spliced variants have been identified. [provided by RefSeq, Sep 2015]

Uniprot Description

RHOA: a small G protein of the Rho family. Regulates a signal transduction pathway linking plasma membrane receptors to the assembly of focal adhesions and actin stress fibers. Controls the reorganization of actins into podosomes. Serves as a target for the yopT cysteine peptidase from Yersinia pestis, vector of the plague, and Yersinia pseudotuberculosis, which causes gastrointestinal disorders.

Protein type: G protein, monomeric, Rho; Oncoprotein; Motility/polarity/chemotaxis; G protein, monomeric; G protein

Chromosomal Location of Human Ortholog: 3p21.3

Cellular Component: apical junction complex; cell cortex; cell junction; cleavage furrow; cytosol; endoplasmic reticulum membrane; endosome; extrinsic to internal side of plasma membrane; focal adhesion; lamellipodium; plasma membrane; vesicle

Molecular Function: GTP binding; GTPase activity; myosin binding; protein binding

Biological Process: actin cytoskeleton organization and biogenesis; actin cytoskeleton reorganization; apical junction assembly; cell migration; endothelial cell migration; ephrin receptor signaling pathway; negative chemotaxis; negative regulation of axonogenesis; phosphoinositide-mediated signaling; platelet activation; positive regulation of axonogenesis; positive regulation of cytokinesis; positive regulation of I-kappaB kinase/NF-kappaB cascade; positive regulation of lipase activity; positive regulation of neuron differentiation; positive regulation of stress fiber formation; regulation of actin cytoskeleton organization and biogenesis; regulation of cell migration; regulation of osteoblast proliferation; regulation of small GTPase mediated signal transduction; Rho protein signal transduction; stress fiber formation; substantia nigra development; transforming growth factor beta receptor signaling pathway; vascular endothelial growth factor receptor signaling pathway; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on RHOA

Similar Products

Product Notes

The RHOA rhoa (Catalog #AAA1275388) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcca tccggaagaa actggtgatt gttggtgatg gagcctgtgg aaagacatgc ttgctcatag tcttcagcaa ggaccagttc ccagaggtgt atgtgcccac agtgtttgag aactatgtgg cagatatcga ggtggatgga aagcaggtag aattggcttt gtgggacaca gctgggcagg aagattatga tcgcctgagg cccctctcct acccagatac cgatgttata ctgatgtgtt tttccatcga cagccctgat agtttagaaa acatcccaga aaagtggacc ccagaagtca agcatttctg tcccaacgtg cccatcatcc tggttgggaa taagaaggat cttcggaatg atgagcacac aaggcgggag ctagccaaga tgaagcagga gccggtgaaa cctgaagaag gcagagatat ggcaaacagg attggcgctt ttgggtacat ggagtgttca gcaaagacca aagatggagt gagagaggtt tttgaaatgg ctacgagagc tgctctgcaa gctagacgtg ggaagaaaaa atctgggtgc cttgtcttgt ga. It is sometimes possible for the material contained within the vial of "RHOA, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.