RGS3 cdna clone
RGS3 cDNA Clone
Gene Names
RGS3; C2PA; RGP3
Synonyms
RGS3; RGS3 cDNA Clone; RGS3 cdna clone
Sequence
atgaaccgcttcaatgggctctgcaaggtgtgctcggagcgccgctaccgccagatcaccatcccgaggggaaaggacggctttggcttcaccatctgctgcgactctccagttcgagtccaggccgtggattccgggggtccggcggaacgggcagggctgcagcagctggacacggtgctgcagctgaatgagaggcctgtggagcactggaaatgtgtggagctggcccacgagatccggagctgccccagtgagatcatcctactcgtgtggcgcatggtcccccaggtcaagccaggaccagatggcggggtcctgcggcgggcctcctgcaagtcgacacatgacctccagtcaccccccaacaaacgggagaagaactgcacccatggggtccaggcacggcctgagcagcgccacagctgccacctggtatgtgacagctctgatgggctgctgctcggcggctgggagcgctacaccgaggtggccaagcgcgggggccagcacaccctgcctgcactgtcccgtgccactgcccccaccgaccccaactacatcatcctggccccgctgaatcctgggagccagctgctccggcctgtgtaccaggaggataccatccccgaagaatcagggagtcccagtaaagggaagtcctacacaggcctggggaagaagtcccggctgatgaagacagtgcagaccatgaagggccacgggaactaccaaaactgcccggttgtgaggccgcatgccacgcactcaagctatggcacctacgtcaccctggcccccaaagtcctggtgttccctgtctttgttcagcctctagatctctgtaatcctgcccggaccctcctgctgtcagaggagctgctgctgtatgaagggaggaacaaggctgccgaggtgacactgtttgcctattcggacctgctgctcttcaccaaggaggacgagcctggccgctgcgacgtcctgaggaaccccctctacctccagagtgtgaagctgcaggaaggttcttcagaagacctgaaattctgcgtgctctatctagcagagaaggcagagtgcttattcactttggaagcgcactcgcaggagcagaagaagagagtgtgctggtgcctgtcggagaacatcgccaagcagcaacagctggcagcatcacccccggacagcaagatgtttgagacggaggcagatgagaagagggagatggccttggaggaagggaaggggcctggtgccgaggattccccacccagcaaggagccctctcctggccaggagcttcctccaggacaagaccttccacccagcaaggactccccttctgggcaggaacccgctcccagccaagaaccactgtccagcaaagactcagctacctctgaaggatcccctccaggcccagatgctccgcccagcaaggatgtgccaccatgccaggaaccccctccagcccaagacctctcaccctgccaggacctacctgctggtcaagaacccctgcctcaccaggaccctctactcaccaaagacctccctgccatccaggaatcccccacccgggaccttccaccctgtcaagatctgcctcctagccaggtctccctgccagccaaggcccttactgaggacaccatgagctccggggacctactagcagctactggggacccacctgcggcccccaggccagccttcgtgatccctgaggtccggctggatagcacctacagccagaaggcaggggcagagcagggctgctcgggagatgaggaggatgcagaagaggccgaggaggtggaggagggggaggaaggggaggaggacgaggatgaggacaccagcgatgacaactacggagagcgcagtgaggccaagcgcagcagcatgatcgagacgggccagggggctgagggtggcctctcactgcgtgtgcagaactcgctgcggcgccggacgcacagcgagggcagcctgctgcaggagccccgagggccctgctttgcctccgacaccaccttgcactgctcagacggtgagggcgccgcctccacctggggcatgccttcgcccagcaccctcaagaaagagctgggccgcaatggtggctccatgcaccacctttccctcttcttcacaggacacaggaagatgagcggggctgacaccgttggggatgatgacgaagcctcccggaagagaaagagcaaaaacctagccaaggacatgaagaacaagctggggatcttcagacggcggaatgagtcccctggagcccctcccgcgggcaaggcagacaaaatgatgaagtcattcaagcccacctcagaggaagccctcaagtggggcgagtccttggagaagctgctggttcacaaatacgggttagcagtgttccaagccttccttcgcactgagttcagtgaggagaatctggagttctggttggcttgtgaggacttcaagaaggtcaagtcacagtccaagatggcatccaaggccaagaagatctttgctgaatacatcgcgatccaggcatgcaaggaggtcaacctggactcctacacgcgggagcacaccaaggacaacctgcagagcgtcacgcggggctgcttcgacctggcacagaagcgcatcttcgggctcatggaaaaggactcgtaccctcgctttctccgttctgacctctacctggaccttattaaccagaagaagatgagtcccccgctttag
Sequence Length
2754
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
66,478 Da
NCBI Official Full Name
Homo sapiens regulator of G-protein signaling 3, mRNA
NCBI Official Synonym Full Names
regulator of G-protein signaling 3
NCBI Official Symbol
RGS3
NCBI Official Synonym Symbols
C2PA; RGP3
NCBI Protein Information
regulator of G-protein signaling 3
UniProt Protein Name
Regulator of G-protein signaling 3
Protein Family
UniProt Gene Name
RGS3
UniProt Synonym Gene Names
RGP3; RGS3
UniProt Entry Name
RGS3_HUMAN
NCBI Description
This gene encodes a member of the regulator of G-protein signaling (RGS) family. This protein is a GTPase-activating protein that inhibits G-protein-mediated signal transduction. Alternative splicing and the use of alternative promoters results in multiple transcript variants encoding different isoforms. Long isoforms are largely cytosolic and plasma membrane-associated with a function in Wnt signaling and in the epithelial mesenchymal transition, while shorter N-terminally-truncated isoforms can be nuclear. [provided by RefSeq, Jan 2013]
Uniprot Description
RGS3: Down-regulates signaling from heterotrimeric G-proteins by increasing the GTPase activity of the alpha subunits, thereby driving them into their inactive GDP-bound form. Down-regulates G- protein-mediated release of inositol phosphates and activation of MAP kinases. 6 isoforms of the human protein are produced by alternative splicing.
Protein type: GAPs; GAPs, RGS
Chromosomal Location of Human Ortholog: 9q32
Cellular Component: cytoplasm; cytosol; nucleoplasm; plasma membrane
Molecular Function: GTPase activator activity; protein binding
Biological Process: inactivation of MAPK activity; regulation of G-protein coupled receptor protein signaling pathway
Research Articles on RGS3
Similar Products
Product Notes
The RGS3 rgs3 (Catalog #AAA1268824) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaccgct tcaatgggct ctgcaaggtg tgctcggagc gccgctaccg ccagatcacc atcccgaggg gaaaggacgg ctttggcttc accatctgct gcgactctcc agttcgagtc caggccgtgg attccggggg tccggcggaa cgggcagggc tgcagcagct ggacacggtg ctgcagctga atgagaggcc tgtggagcac tggaaatgtg tggagctggc ccacgagatc cggagctgcc ccagtgagat catcctactc gtgtggcgca tggtccccca ggtcaagcca ggaccagatg gcggggtcct gcggcgggcc tcctgcaagt cgacacatga cctccagtca ccccccaaca aacgggagaa gaactgcacc catggggtcc aggcacggcc tgagcagcgc cacagctgcc acctggtatg tgacagctct gatgggctgc tgctcggcgg ctgggagcgc tacaccgagg tggccaagcg cgggggccag cacaccctgc ctgcactgtc ccgtgccact gcccccaccg accccaacta catcatcctg gccccgctga atcctgggag ccagctgctc cggcctgtgt accaggagga taccatcccc gaagaatcag ggagtcccag taaagggaag tcctacacag gcctggggaa gaagtcccgg ctgatgaaga cagtgcagac catgaagggc cacgggaact accaaaactg cccggttgtg aggccgcatg ccacgcactc aagctatggc acctacgtca ccctggcccc caaagtcctg gtgttccctg tctttgttca gcctctagat ctctgtaatc ctgcccggac cctcctgctg tcagaggagc tgctgctgta tgaagggagg aacaaggctg ccgaggtgac actgtttgcc tattcggacc tgctgctctt caccaaggag gacgagcctg gccgctgcga cgtcctgagg aaccccctct acctccagag tgtgaagctg caggaaggtt cttcagaaga cctgaaattc tgcgtgctct atctagcaga gaaggcagag tgcttattca ctttggaagc gcactcgcag gagcagaaga agagagtgtg ctggtgcctg tcggagaaca tcgccaagca gcaacagctg gcagcatcac ccccggacag caagatgttt gagacggagg cagatgagaa gagggagatg gccttggagg aagggaaggg gcctggtgcc gaggattccc cacccagcaa ggagccctct cctggccagg agcttcctcc aggacaagac cttccaccca gcaaggactc cccttctggg caggaacccg ctcccagcca agaaccactg tccagcaaag actcagctac ctctgaagga tcccctccag gcccagatgc tccgcccagc aaggatgtgc caccatgcca ggaaccccct ccagcccaag acctctcacc ctgccaggac ctacctgctg gtcaagaacc cctgcctcac caggaccctc tactcaccaa agacctccct gccatccagg aatcccccac ccgggacctt ccaccctgtc aagatctgcc tcctagccag gtctccctgc cagccaaggc ccttactgag gacaccatga gctccgggga cctactagca gctactgggg acccacctgc ggcccccagg ccagccttcg tgatccctga ggtccggctg gatagcacct acagccagaa ggcaggggca gagcagggct gctcgggaga tgaggaggat gcagaagagg ccgaggaggt ggaggagggg gaggaagggg aggaggacga ggatgaggac accagcgatg acaactacgg agagcgcagt gaggccaagc gcagcagcat gatcgagacg ggccaggggg ctgagggtgg cctctcactg cgtgtgcaga actcgctgcg gcgccggacg cacagcgagg gcagcctgct gcaggagccc cgagggccct gctttgcctc cgacaccacc ttgcactgct cagacggtga gggcgccgcc tccacctggg gcatgccttc gcccagcacc ctcaagaaag agctgggccg caatggtggc tccatgcacc acctttccct cttcttcaca ggacacagga agatgagcgg ggctgacacc gttggggatg atgacgaagc ctcccggaag agaaagagca aaaacctagc caaggacatg aagaacaagc tggggatctt cagacggcgg aatgagtccc ctggagcccc tcccgcgggc aaggcagaca aaatgatgaa gtcattcaag cccacctcag aggaagccct caagtggggc gagtccttgg agaagctgct ggttcacaaa tacgggttag cagtgttcca agccttcctt cgcactgagt tcagtgagga gaatctggag ttctggttgg cttgtgagga cttcaagaag gtcaagtcac agtccaagat ggcatccaag gccaagaaga tctttgctga atacatcgcg atccaggcat gcaaggaggt caacctggac tcctacacgc gggagcacac caaggacaac ctgcagagcg tcacgcgggg ctgcttcgac ctggcacaga agcgcatctt cgggctcatg gaaaaggact cgtaccctcg ctttctccgt tctgacctct acctggacct tattaaccag aagaagatga gtcccccgct ttag. It is sometimes possible for the material contained within the vial of "RGS3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
