RFXANK cdna clone

RFXANK cDNA Clone

Cat. Num. AAA1275425

• Gene Names: RFXANK; BLS; RFX-B; ANKRA1; F14150_1
• Synonyms: RFXANK; RFXANK cDNA Clone; RFXANK cdna clone

• Sequence: ATGGAGCTTACCCAGCCTGCAGAAGACCTCATCCAGACCCAGCAGACCCCTGCCTCAGAACTTGGGGACCCTGAAGACCCCGGAGAGGAGGCTGCAGATGGCTCAGACACTGTGGTCCTCAGTCTCTTTCCCTGCACCCCTGAGCCTGTGAATCCTGAACCGGATGCCAGTGTTTCCTCTCCACAGGCAGGCAGCTCCCTGAAGCACTCCACCACTCTCACCAACCGGCAGCGAGGGAACGAGGTGTCAGCTCTGCCGGCCACCCTAGACTCCCTGTCCATCCACCAGCTCGCAGCACAGGGGGAGCTGGACCAGCTGAAGGAGCATTTGCGGAAAGGTGACAACCTCGTCAACAAGCCAGACGAGCGCGGCTTCACCCCCCTCATCTGGGCCTCCGCCTTTGGAGAGATTGAGACCGTTCGCTTCCTGCTGGAGTGGGGTGCCGACCCCCACATCCTGGCAAAAGAGCGAGAGAGCGCCCTGTCGCTGGCCAGCACAGGCGGCTACACAGACATTGTGGGGCTGCTGCTGGAGCGTGACGTGGACATCAACATCTATGATTGGAATGGAGGGACGCCACTGCTGTACGCTGTGCGCGGGAACCACGTGAAATGCGTTGAGGCCTTGCTGGCCCGAGGCGCTGACCTCACCACCGAAGCCGACTCTGGCTACACCCCGATGGACCTTGCCGTGGCCCTGGGATACCGGAAAGTGCAACAGGTGATCGAGAACCACATCCTCAAGCTCTTCCAGAGCAACCTGGTGCCCGCTGACCCTGAGTGA
• Sequence Length: 783

• Vector: Please Inquire

NCBI and Uniprot Product Information

• NCBI GI #: 90112104
• NCBI GeneID: 8625
• Molecular Weight: 25,652 Da
• NCBI Official Full Name: Homo sapiens regulatory factor X-associated ankyrin-containing protein, transcript variant 1, mRNA
• NCBI Official Synonym Full Names: regulatory factor X associated ankyrin containing protein
• NCBI Official Symbol: RFXANK
• NCBI Official Synonym Symbols: BLS; RFX-B; ANKRA1; F14150_1
• NCBI Protein Information: DNA-binding protein RFXANK
• UniProt Protein Name: DNA-binding protein RFXANK
• Protein Family: DNA-binding protein
• UniProt Gene Name: RFXANK
• UniProt Synonym Gene Names: ANKRA1; RFXB; RFX-B
• UniProt Entry Name: RFXK_HUMAN

NCBI Description

Major histocompatibility (MHC) class II molecules are transmembrane proteins that have a central role in development and control of the immune system. The protein encoded by this gene, along with regulatory factor X-associated protein and regulatory factor-5, forms a complex that binds to the X box motif of certain MHC class II gene promoters and activates their transcription. Once bound to the promoter, this complex associates with the non-DNA-binding factor MHC class II transactivator, which controls the cell type specificity and inducibility of MHC class II gene expression. This protein contains ankyrin repeats involved in protein-protein interactions. Mutations in this gene have been linked to bare lymphocyte syndrome type II, complementation group B. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2013]

Uniprot Description

RFXANK: Activates transcription from class II MHC promoters. Activation requires the activity of the MHC class II transactivator (MHC2TA). May regulate other genes in the cell. RFX binds the X1 box of MHC-II promoters. Isoform RFX-B-delta5 is not involved in the positive regulation of MHC class II genes. Defects in RFXANK are a cause of bare lymphocyte syndrome type 2 (BLS2); also known as hereditary MHC class II deficiency or HLA class II-deficient combined immunodeficiency. BLS2 is a severe combined immunodeficiency disease with early onset. It is characterized by a profound defect in constitutive and interferon-gamma induced MHC II expression, absence of cellular and humoral T-cell response to antigen challenge, hypogammaglobulinemia and impaired antibody production. The consequence include extreme susceptibility to viral, bacterial and fungal infections. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding; Transcription, coactivator/corepressor

Chromosomal Location of Human Ortholog: 19p12

Cellular Component: cytoplasm; intercellular bridge; nucleoplasm; nucleus

Molecular Function: transcription cofactor activity

Biological Process: regulation of transcription from RNA polymerase II promoter

Disease: Bare Lymphocyte Syndrome, Type Ii