Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RFFL cdna clone

RFFL cDNA Clone

Gene Names
RFFL; CARP2; FRING; CARP-2; RNF189; RNF34L; RIFIFYLIN
Synonyms
RFFL; RFFL cDNA Clone; RFFL cdna clone
Ordering
For Research Use Only!
Sequence
atgtgggcaacctgctgcaactggttctgcctggatggacagcctgaggaggtcccaccaccccagggagccaggatgcaggcctattccaaccctgggtacagctccttcccttccccaacaggcttggaaccaagctgcaagtcctgtggggctcactttgcaaacacggccaggaagcagacctgcttggactgtaagaaaaatttttgcatgacctgttcgagccaagtagggaatgggccccgcctctgccttctctgccaacggtttcgagctacagcctttcagcgagaggagctcatgaagatgaaggtgaaggacttgagggactatctcagcctccatgacatctctaccgaaatgtgccgggagaaaggagagctggtgctcttggtccttggccagcagcctgtaatctcccaggaggacaggactcgtgcctccaccttgtccccagactttcctgagcagcaggccttcctgacccagcctcactccagcatggttccacctacctcacccaacctcccctcttcatctgcacaagccacctctgttcccccagcccaggttcaggagaatcagcagtctattgactcagaggacagctttgtcccaggccgaagggcctctctgtctgacctgactgacctggaggacattgaaggcctgacagtgcggcagctgaaagagatcttggctcgcaactttgtcaactacaagggctgctgtgagaagtgggagctgatggagagagtgacccggctatacaaggatcagaaaggactccagcacctggggggagcagtaccatcaggcttggaggagaacctgtgtaagatctgcatggactcacccattgactgtgttcttctggagtgtggccacatggtaacctgtaccaagtgtggcaagcgcatgaatgaatgtcccatctgccggcagtatgtaatccgagctgtgcatgtcttccggtcctga
Sequence Length
984
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
36,633 Da
NCBI Official Full Name
Homo sapiens ring finger and FYVE-like domain containing 1, mRNA
NCBI Official Synonym Full Names
ring finger and FYVE like domain containing E3 ubiquitin protein ligase
NCBI Official Symbol
RFFL
NCBI Official Synonym Symbols
CARP2; FRING; CARP-2; RNF189; RNF34L; RIFIFYLIN
NCBI Protein Information
E3 ubiquitin-protein ligase rififylin
UniProt Protein Name
E3 ubiquitin-protein ligase rififylin
UniProt Gene Name
RFFL
UniProt Synonym Gene Names
CARP-2; Fring
UniProt Entry Name
RFFL_HUMAN

Uniprot Description

RFFL: Has E3 ubiquitin protein ligase activity. Regulates the levels of CASP8 and CASP10 by targeting them for proteasomal degradation. Has anti-apoptotic activity. May bind phosphatidylinositol phosphates. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system; Vesicle; EC 6.3.2.-; Ubiquitin ligase; Ligase

Chromosomal Location of Human Ortholog: 17q12

Cellular Component: cytoplasm; endosome membrane; Golgi membrane; lysosome; membrane; nucleoplasm; plasma membrane

Molecular Function: p53 binding; protease binding; protein binding; protein kinase binding; ubiquitin protein ligase binding

Biological Process: proteasomal ubiquitin-dependent protein catabolic process; protein ubiquitination during ubiquitin-dependent protein catabolic process; regulation of TOR signaling pathway; ubiquitin-dependent protein catabolic process

Research Articles on RFFL

Similar Products

Product Notes

The RFFL rffl (Catalog #AAA1276178) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtgggcaa cctgctgcaa ctggttctgc ctggatggac agcctgagga ggtcccacca ccccagggag ccaggatgca ggcctattcc aaccctgggt acagctcctt cccttcccca acaggcttgg aaccaagctg caagtcctgt ggggctcact ttgcaaacac ggccaggaag cagacctgct tggactgtaa gaaaaatttt tgcatgacct gttcgagcca agtagggaat gggccccgcc tctgccttct ctgccaacgg tttcgagcta cagcctttca gcgagaggag ctcatgaaga tgaaggtgaa ggacttgagg gactatctca gcctccatga catctctacc gaaatgtgcc gggagaaagg agagctggtg ctcttggtcc ttggccagca gcctgtaatc tcccaggagg acaggactcg tgcctccacc ttgtccccag actttcctga gcagcaggcc ttcctgaccc agcctcactc cagcatggtt ccacctacct cacccaacct cccctcttca tctgcacaag ccacctctgt tcccccagcc caggttcagg agaatcagca gtctattgac tcagaggaca gctttgtccc aggccgaagg gcctctctgt ctgacctgac tgacctggag gacattgaag gcctgacagt gcggcagctg aaagagatct tggctcgcaa ctttgtcaac tacaagggct gctgtgagaa gtgggagctg atggagagag tgacccggct atacaaggat cagaaaggac tccagcacct ggggggagca gtaccatcag gcttggagga gaacctgtgt aagatctgca tggactcacc cattgactgt gttcttctgg agtgtggcca catggtaacc tgtaccaagt gtggcaagcg catgaatgaa tgtcccatct gccggcagta tgtaatccga gctgtgcatg tcttccggtc ctga. It is sometimes possible for the material contained within the vial of "RFFL, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.