Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RET cdna clone

RET cDNA Clone

Gene Names
RET; PTC; MTC1; HSCR1; MEN2A; MEN2B; RET51; CDHF12; CDHR16; RET-ELE1
Synonyms
RET; RET cDNA Clone; RET cdna clone
Ordering
For Research Use Only!
Sequence
atggcgaaggcgacgtccggtgccgcggggctgcgtctgctgttgctgctgctgctgccgctgctaggcaaagtggcattgggcctctacttctcgagggatgcttactgggagaagctgtatgtggaccaggcggccggcacgcccttgctgtacgtccatgccctgcgggacgcccctgaggaggtgcccagcttccgcctgggccagcatctctacggcacgtaccgcacacggctgcatgagaacaactggatctgcatccaggaggacaccggcctcctctaccttaaccggagcctggaccatagctcctgggagaagctcagtgtccgcaaccgcggctttcccctgctcaccgtctacctcaaggtcttcctgtcacccacatcccttcgtgagggcgagtgccagtggccaggctgtgcccgcgtatacttctccttcttcaacacctcctttccagcctgcagctccctcaagccccgggagctctgcttcccagagacaaggccctccttccgcattcgggagaaccgacccccaggcaccttccaccagttccgcctgctgcctgtgcagttcttgtgccccaacatcagcgtggcctacaggctcctggagggtgagggtctgcccttccgctgcgccccggacagcctggaggtgagcacgcgctgggccctggaccgcgagcagcgggagaagtacgagctggtggccgtgtgcaccgtgcacgccggcgcgcgcgaggaggtggtgatggtgcccttcccggtgaccgtgtacgacgaggacgactcggcgcccaccttccccgcgggcgtcgacaccgccagcgccgtggtggagttcaagcggaaggaggacaccgtggtggccacgctgcgtgtcttcgatgcagacgtggtacctgcatcaggggagctggtgaggcggtacacaagcacgctgctccccggggacacctgggcccagcagaccttccgggtggaacactggcccaacgagacctcggtccaggccaacggcagcttcgtgcgggcgaccgtacatgactataggctggttctcaaccggaacctctccatctcggagaaccgcaccatgcagctggcggtgctggtcaatgactcagacttccagggcccaggagcgggcgtcctcttgctccacttcaacgtgtcggtgctgccggtcagcctgcacctgcccagtacctactccctctccgtgagcaggagggctcgccgatttgcccagatcgggaaagtctgtgtggaaaactgcctggcagatctcacaggggatgcagtatctggccgagatgaagctcgttcatcgggacttggcagccagaaacatcctggtagctga
Sequence Length
1377
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
119,847 Da
NCBI Official Full Name
Homo sapiens ret proto-oncogene, mRNA
NCBI Official Synonym Full Names
ret proto-oncogene
NCBI Official Symbol
RET
NCBI Official Synonym Symbols
PTC; MTC1; HSCR1; MEN2A; MEN2B; RET51; CDHF12; CDHR16; RET-ELE1
NCBI Protein Information
proto-oncogene tyrosine-protein kinase receptor Ret
UniProt Protein Name
Proto-oncogene tyrosine-protein kinase receptor Ret
Protein Family
UniProt Gene Name
RET
UniProt Synonym Gene Names
CDHF12; CDHR16; PTC; RET51
UniProt Entry Name
RET_HUMAN

NCBI Description

This gene, a member of the cadherin superfamily, encodes one of the receptor tyrosine kinases, which are cell-surface molecules that transduce signals for cell growth and differentiation. This gene plays a crucial role in neural crest development, and it can undergo oncogenic activation in vivo and in vitro by cytogenetic rearrangement. Mutations in this gene are associated with the disorders multiple endocrine neoplasia, type IIA, multiple endocrine neoplasia, type IIB, Hirschsprung disease, and medullary thyroid carcinoma. Two transcript variants encoding different isoforms have been found for this gene. Additional transcript variants have been described but their biological validity has not been confirmed. [provided by RefSeq, Jul 2008]

Uniprot Description

Ret: a proto-oncogenic receptor tyrosine kinase. Receptor for glial cell line-derived neurotropic factor (GDNF) and its congeners neurturin, persephin and artemin. Part of a multicompetent receptor complex with other membrane-bound ligand-binding GDNF family receptors (aGFRs). Required for development of the kidney and neural crest-derived cell types. Three alternatively spliced isoforms have been described.

Protein type: Oncoprotein; Protein kinase, TK; Protein kinase, tyrosine (receptor); EC 2.7.10.1; Kinase, protein; Membrane protein, integral; TK group; Ret family

Chromosomal Location of Human Ortholog: 10q11.2

Cellular Component: cytoplasm; endosome membrane; integral to plasma membrane; intracellular membrane-bound organelle; plasma membrane; receptor complex

Molecular Function: calcium ion binding; protein binding; protein-tyrosine kinase activity; Ras guanyl-nucleotide exchange factor activity; receptor activity

Biological Process: MAPKKK cascade; membrane protein proteolysis; neuron adhesion; positive regulation of cell adhesion mediated by integrin; positive regulation of cell migration; positive regulation of transcription, DNA-dependent; posterior midgut development; protein amino acid phosphorylation; regulation of cell adhesion; response to pain; signal transduction

Disease: Hirschsprung Disease, Susceptibility To, 1; Multiple Endocrine Neoplasia, Type Iia; Multiple Endocrine Neoplasia, Type Iib; Thyroid Carcinoma, Familial Medullary; Thyroid Carcinoma, Papillary

Research Articles on RET

Similar Products

Product Notes

The RET ret (Catalog #AAA1269839) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgaagg cgacgtccgg tgccgcgggg ctgcgtctgc tgttgctgct gctgctgccg ctgctaggca aagtggcatt gggcctctac ttctcgaggg atgcttactg ggagaagctg tatgtggacc aggcggccgg cacgcccttg ctgtacgtcc atgccctgcg ggacgcccct gaggaggtgc ccagcttccg cctgggccag catctctacg gcacgtaccg cacacggctg catgagaaca actggatctg catccaggag gacaccggcc tcctctacct taaccggagc ctggaccata gctcctggga gaagctcagt gtccgcaacc gcggctttcc cctgctcacc gtctacctca aggtcttcct gtcacccaca tcccttcgtg agggcgagtg ccagtggcca ggctgtgccc gcgtatactt ctccttcttc aacacctcct ttccagcctg cagctccctc aagccccggg agctctgctt cccagagaca aggccctcct tccgcattcg ggagaaccga cccccaggca ccttccacca gttccgcctg ctgcctgtgc agttcttgtg ccccaacatc agcgtggcct acaggctcct ggagggtgag ggtctgccct tccgctgcgc cccggacagc ctggaggtga gcacgcgctg ggccctggac cgcgagcagc gggagaagta cgagctggtg gccgtgtgca ccgtgcacgc cggcgcgcgc gaggaggtgg tgatggtgcc cttcccggtg accgtgtacg acgaggacga ctcggcgccc accttccccg cgggcgtcga caccgccagc gccgtggtgg agttcaagcg gaaggaggac accgtggtgg ccacgctgcg tgtcttcgat gcagacgtgg tacctgcatc aggggagctg gtgaggcggt acacaagcac gctgctcccc ggggacacct gggcccagca gaccttccgg gtggaacact ggcccaacga gacctcggtc caggccaacg gcagcttcgt gcgggcgacc gtacatgact ataggctggt tctcaaccgg aacctctcca tctcggagaa ccgcaccatg cagctggcgg tgctggtcaa tgactcagac ttccagggcc caggagcggg cgtcctcttg ctccacttca acgtgtcggt gctgccggtc agcctgcacc tgcccagtac ctactccctc tccgtgagca ggagggctcg ccgatttgcc cagatcggga aagtctgtgt ggaaaactgc ctggcagatc tcacagggga tgcagtatct ggccgagatg aagctcgttc atcgggactt ggcagccaga aacatcctgg tagctga. It is sometimes possible for the material contained within the vial of "RET, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.