Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

REPIN1 cdna clone

REPIN1 cDNA Clone

Gene Names
REPIN1; AP4; RIP60; ZNF464; Zfp464
Synonyms
REPIN1; REPIN1 cDNA Clone; REPIN1 cdna clone
Ordering
For Research Use Only!
Sequence
atgctggaacgtcgttgcaggggccccctggccatgggcctggcccagccccgactcctttctgggccctcccaggagtcaccccagaccctggggaaggagtcccgcgggctgaggcaacaaggcacgtcagtggcccagtctggtgcccaagccccaggcagggcccatcgctgtgcccactgtcgaaggcacttccctggctgggtggctctgtggcttcacacccgccggtgccaggcccggctgcccttgccctgccctgagtgtggccgtcgctttcgccatgcccccttcttagcactgcaccgccaggtccatgctgctgccaccccagacctgggctttgcctgccacctctgtgggcagagcttccgaggctgggtggccctggttctgcatctgcgggcccattcagctgcaaagcggcccatcgcttgtcccaaatgcgagagacgcttctggcgacgaaagcagcttcgagctcatctgcggcggtgccaccctcccgccccggaggcccggcccttcatatgcggcaactgtggccggagctttgcccagtgggaccagctagttgcccacaagcgggtgcacgtagctgaggccctggaggaggccgcagccaaggctctggggccccggcccaggggccgccccgcggtgaccgccccccggcccggtggagatgccgtcgaccgccccttccagtgtgcctgttgtggcaagcgcttccggcacaagcccaacttgatcgctcaccgccgcgtgcacacgggcgagcggccccaccagtgccccgagtgcgggaagcgctttaccaataagccctatctgacttcgcaccggcgcatccacaccggcgagaagccctacccgtgcaaagagtgcggccgccgcttccggcacaaacccaacctgctgtctcacagcaagattcacaagcgatccgaggggtcggcccaggccgcccccggcccggggagcccccagctgccagccggcccccaggagtccgcggccgagcccaccccggcggtacctctgaaaccggcccaggagccgccgccaggggccccgccagagcacccgcaggacccgatcgaagcccccccctccctctacagctgcgacgactgcggcaggagcttccggctggagcgcttcctgcgggcccaccagcggcagcacaccggggagcggcccttcacctgcgccgagtgcgggaagaacttcggcaagaagacgcacctggtggcgcactcgcgcgtgcactccggcgagcggcccttcgcctgcgaggagtgcggccgccgcttctcccagggcagccatctggcggcgcatcggcgcgaccacgcccccgatcggcccttcgtgtgtcccgactgcggcaaggccttccgccacaaaccctacctggcggcgcaccggcgcatccacaccggcgagaagccctacgtctgccccgactgcggcaaagccttcagccagaagtccaacctggtgtcgcaccggcgcatccacacgggcgagcggccctacgcctgtcccgactgcgaccgcagcttcagccagaagtccaacctcatcacccaccgcaagagccacatccgggacggcgccttctgctgtgccatctgtggccagaccttcgacgacgaggagagactcctggcccaccagaagaagcacgatgtctga
Sequence Length
1704
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
69,920 Da
NCBI Official Full Name
Homo sapiens replication initiator 1, mRNA
NCBI Official Synonym Full Names
replication initiator 1
NCBI Official Symbol
REPIN1
NCBI Official Synonym Symbols
AP4; RIP60; ZNF464; Zfp464
NCBI Protein Information
replication initiator 1
UniProt Protein Name
Replication initiator 1
Protein Family
UniProt Gene Name
REPIN1
UniProt Synonym Gene Names
RIP60; ZNF464
UniProt Entry Name
REPI1_HUMAN

Uniprot Description

REPIN1: Sequence-specific double-stranded DNA-binding protein required for initiation of chromosomal DNA replication. Binds on 5'-ATT-3' reiterated sequences downstream of the origin of bidirectional replication (OBR) and a second, homologous ATT sequence of opposite orientation situated within the OBR zone. Facilitates DNA bending. Homodimers and homomultimers. Found in a complex with RIP60 and RIP100.

Protein type: C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 7q36.1

Cellular Component: nuclear origin of replication recognition complex; nucleus

Research Articles on REPIN1

Similar Products

Product Notes

The REPIN1 repin1 (Catalog #AAA1272897) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggaac gtcgttgcag gggccccctg gccatgggcc tggcccagcc ccgactcctt tctgggccct cccaggagtc accccagacc ctggggaagg agtcccgcgg gctgaggcaa caaggcacgt cagtggccca gtctggtgcc caagccccag gcagggccca tcgctgtgcc cactgtcgaa ggcacttccc tggctgggtg gctctgtggc ttcacacccg ccggtgccag gcccggctgc ccttgccctg ccctgagtgt ggccgtcgct ttcgccatgc ccccttctta gcactgcacc gccaggtcca tgctgctgcc accccagacc tgggctttgc ctgccacctc tgtgggcaga gcttccgagg ctgggtggcc ctggttctgc atctgcgggc ccattcagct gcaaagcggc ccatcgcttg tcccaaatgc gagagacgct tctggcgacg aaagcagctt cgagctcatc tgcggcggtg ccaccctccc gccccggagg cccggccctt catatgcggc aactgtggcc ggagctttgc ccagtgggac cagctagttg cccacaagcg ggtgcacgta gctgaggccc tggaggaggc cgcagccaag gctctggggc cccggcccag gggccgcccc gcggtgaccg ccccccggcc cggtggagat gccgtcgacc gccccttcca gtgtgcctgt tgtggcaagc gcttccggca caagcccaac ttgatcgctc accgccgcgt gcacacgggc gagcggcccc accagtgccc cgagtgcggg aagcgcttta ccaataagcc ctatctgact tcgcaccggc gcatccacac cggcgagaag ccctacccgt gcaaagagtg cggccgccgc ttccggcaca aacccaacct gctgtctcac agcaagattc acaagcgatc cgaggggtcg gcccaggccg cccccggccc ggggagcccc cagctgccag ccggccccca ggagtccgcg gccgagccca ccccggcggt acctctgaaa ccggcccagg agccgccgcc aggggccccg ccagagcacc cgcaggaccc gatcgaagcc cccccctccc tctacagctg cgacgactgc ggcaggagct tccggctgga gcgcttcctg cgggcccacc agcggcagca caccggggag cggcccttca cctgcgccga gtgcgggaag aacttcggca agaagacgca cctggtggcg cactcgcgcg tgcactccgg cgagcggccc ttcgcctgcg aggagtgcgg ccgccgcttc tcccagggca gccatctggc ggcgcatcgg cgcgaccacg cccccgatcg gcccttcgtg tgtcccgact gcggcaaggc cttccgccac aaaccctacc tggcggcgca ccggcgcatc cacaccggcg agaagcccta cgtctgcccc gactgcggca aagccttcag ccagaagtcc aacctggtgt cgcaccggcg catccacacg ggcgagcggc cctacgcctg tcccgactgc gaccgcagct tcagccagaa gtccaacctc atcacccacc gcaagagcca catccgggac ggcgccttct gctgtgccat ctgtggccag accttcgacg acgaggagag actcctggcc caccagaaga agcacgatgt ctga. It is sometimes possible for the material contained within the vial of "REPIN1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.