Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RBBP6 cdna clone

RBBP6 cDNA Clone

Gene Names
RBBP6; PACT; MY038; P2P-R; RBQ-1; SNAMA
Synonyms
RBBP6; RBBP6 cDNA Clone; RBBP6 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcctgtgtgcattataaattttcctctaaactcaactatgataccgtcacctttgatgggctccacatctccctctgcgacttaaagaagcagattatggggagagagaagctgaaagctgccgactgcgacctgcagatcaccaatgcgcagacgaaagaagaatatactgatgataatgctctgattcctaagaattcttctgtaattgttagaagaattcctattggaggtgttaaatctacaagcaagacatatgttataagtcgaactgaaccagcgatggcaactacaaaagcagtatgtaaaaacacaatctcacactttttctacacattgcttttacctttataa
Sequence Length
357
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
106,037 Da
NCBI Official Full Name
Homo sapiens retinoblastoma binding protein 6, mRNA
NCBI Official Synonym Full Names
RB binding protein 6, ubiquitin ligase
NCBI Official Symbol
RBBP6
NCBI Official Synonym Symbols
PACT; MY038; P2P-R; RBQ-1; SNAMA
NCBI Protein Information
E3 ubiquitin-protein ligase RBBP6
UniProt Protein Name
E3 ubiquitin-protein ligase RBBP6
UniProt Gene Name
RBBP6
UniProt Synonym Gene Names
P2PR; PACT; RBQ1; RBQ-1
UniProt Entry Name
RBBP6_HUMAN

NCBI Description

The retinoblastoma tumor suppressor (pRB) protein binds with many other proteins. In various human cancers, pRB suppresses cellular proliferation and is inactivated. Cell cycle-dependent phosphorylation regulates the activity of pRB. This gene encodes a protein which binds to underphosphorylated but not phosphorylated pRB. Multiple alternatively spliced transcript variants that encode different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

RBBP6: E3 ubiquitin-protein ligase which promotes ubiquitination of YBX1, leading to its degradation by the proteasome. May play a role as a scaffold protein to promote the assembly of the p53/TP53-MDM2 complex, resulting in increase of MDM2-mediated ubiquitination and degradation of p53/TP53; may function as negative regulator of p53/TP53, leading to both apoptosis and cell growth. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin ligase; EC 6.3.2.-; Ubiquitin conjugating system; Nucleolus; Ligase; Cell cycle regulation; EC 6.3.2.19

Chromosomal Location of Human Ortholog: 16p12.2

Cellular Component: cytosol; nucleoplasm

Molecular Function: protein binding; ubiquitin-protein ligase activity

Biological Process: protein polyubiquitination; protein ubiquitination during ubiquitin-dependent protein catabolic process; regulation of DNA replication; response to DNA damage stimulus

Research Articles on RBBP6

Similar Products

Product Notes

The RBBP6 rbbp6 (Catalog #AAA1273291) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcctgtg tgcattataa attttcctct aaactcaact atgataccgt cacctttgat gggctccaca tctccctctg cgacttaaag aagcagatta tggggagaga gaagctgaaa gctgccgact gcgacctgca gatcaccaat gcgcagacga aagaagaata tactgatgat aatgctctga ttcctaagaa ttcttctgta attgttagaa gaattcctat tggaggtgtt aaatctacaa gcaagacata tgttataagt cgaactgaac cagcgatggc aactacaaaa gcagtatgta aaaacacaat ctcacacttt ttctacacat tgcttttacc tttataa. It is sometimes possible for the material contained within the vial of "RBBP6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.