Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RASSF6 cdna clone

RASSF6 cDNA Clone

Synonyms
RASSF6; RASSF6 cDNA Clone; RASSF6 cdna clone
Ordering
For Research Use Only!
Sequence
atggctcaccagtacccctcttggatcttcattaatgagaagacattcataaccagggaacaacttaattctttattgaagacctataacattttttatgagaaccagaaaaatctgcatattttatatggagagactgaagatggcaaactaattgttgaaggaatgctggacattttctggggagtaaaacgacctatacagctaaaaatacaagatgagaagccattctcttcttttactagtatgaagtcatcagacgtcttctccagcaaaggaatgacacgctggggggaatttgacgatctctatcgtattagtgagctggacaggacccagattcctatgtctgaaaaaaggaattcccaggaagactatttaccttatcacagcaacaccctgaagccacatgcaaaggatgaaccagactccccagtgctctatagaaccatgagtgaagcagctctggtgagaaaaaggatgaagcctctgatgatggacagaaaagaaagacagaaaaatagagcctctattaatggacacttctataaccatgaaattgaaaatagtccccaggattttgctcttcacattatttttgcaacaggagaacaaagacgactaaagaagacagacattccgctactgcagaggctcctacagggaccttctgaaaagaatgctcgcattttcctcatggataaagatgcagaagaaattagcagtgatgtggctcagtacattaactttcacttttctctcttggaatccattcttcaaagattaaatgaagaagagaaaagagagattcaaagaatagtaacaaaattcaataaagaaaaggcgattatactgaaatgtcttcaaaataaactagtaataaaaacagagacaacagtttag
Sequence Length
903
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,809 Da
NCBI Official Full Name
Homo sapiens Ras association (RalGDS/AF-6) domain family member 6, mRNA
NCBI Official Synonym Full Names
Ras association domain family member 6
NCBI Official Symbol
RASSF6
NCBI Protein Information
ras association domain-containing protein 6
UniProt Protein Name
Ras association domain-containing protein 6
UniProt Gene Name
RASSF6
UniProt Entry Name
RASF6_HUMAN

NCBI Description

This gene encodes a member of the Ras-association domain family (RASSF). Members of this family form the core of a highly conserved tumor suppressor network, the Salvador-Warts-Hippo (SWH) pathway. The protein encoded by this gene is a Ras effector protein that induces apoptosis. A genomic region containing this gene has been linked to susceptibility to viral bronchiolitis. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jul 2012]

Uniprot Description

RASSF6: Involved in the induction of apoptosis, through both caspase-dependent and caspase-independent pathways. May act as a Ras effector protein. May suppress the serum-induced basal levels of NF-kappa-B. 4 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 4q13.3

Molecular Function: protein binding

Research Articles on RASSF6

Similar Products

Product Notes

The RASSF6 rassf6 (Catalog #AAA1274563) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctcacc agtacccctc ttggatcttc attaatgaga agacattcat aaccagggaa caacttaatt ctttattgaa gacctataac attttttatg agaaccagaa aaatctgcat attttatatg gagagactga agatggcaaa ctaattgttg aaggaatgct ggacattttc tggggagtaa aacgacctat acagctaaaa atacaagatg agaagccatt ctcttctttt actagtatga agtcatcaga cgtcttctcc agcaaaggaa tgacacgctg gggggaattt gacgatctct atcgtattag tgagctggac aggacccaga ttcctatgtc tgaaaaaagg aattcccagg aagactattt accttatcac agcaacaccc tgaagccaca tgcaaaggat gaaccagact ccccagtgct ctatagaacc atgagtgaag cagctctggt gagaaaaagg atgaagcctc tgatgatgga cagaaaagaa agacagaaaa atagagcctc tattaatgga cacttctata accatgaaat tgaaaatagt ccccaggatt ttgctcttca cattattttt gcaacaggag aacaaagacg actaaagaag acagacattc cgctactgca gaggctccta cagggacctt ctgaaaagaa tgctcgcatt ttcctcatgg ataaagatgc agaagaaatt agcagtgatg tggctcagta cattaacttt cacttttctc tcttggaatc cattcttcaa agattaaatg aagaagagaa aagagagatt caaagaatag taacaaaatt caataaagaa aaggcgatta tactgaaatg tcttcaaaat aaactagtaa taaaaacaga gacaacagtt tag. It is sometimes possible for the material contained within the vial of "RASSF6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.