Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RASGRP2 cdna clone

RASGRP2 cDNA Clone

Gene Names
RASGRP2; CDC25L; CALDAG-GEFI
Synonyms
RASGRP2; RASGRP2 cDNA Clone; RASGRP2 cdna clone
Ordering
For Research Use Only!
Sequence
atggcaggcaccctggacctggacaagggctgcacggtggaggagctgctccgcgggtgcatcgaagccttcgatgactccgggaaggtgcgggacccgcagctggtgcgcatgttcctcatgatgcacccctggtacatcccctcctctcagctggcggccaagctgctccacatctaccaacaatcccggaaggacaactccaattccctgcaggtgaaaacgtgccacctggtcaggtactggatctccgccttcccagcggagtttgacttgaacccggagttggctgagcagatcaaggagctgaaggctctgctagaccaagaagggaaccgacggcacagcagcctaatcgacatagacagcgtccctacctacaagtggaagcggcaggtgactcagcggaaccctgtgggacagaaaaagcgcaagatgtccctgttgtttgaccacctggagcccatggagctggcggagcatctcacctacttggagtatcgctccttctgcaagatcctgtttcaggactatcacagtttcgtgactcatggctgcactgtggacaaccccgtcctggagcggttcatctccctcttcaacagcgtctcacagtgggtgcagctcatgatcctcagcaaacccacagccccgcagcgggccctggtcatcacacactttgtccacgtggcggagaagctgctacagctgcagaacttcaacacgctgatggcagtggtcgggggcctgagccacagctccatctcccgcctcaaggagacccacagccacgttagccctgagaccatcaagctctgggagggtctcacggaactagtgacggcgacaggcaactatggcaactaccggcgtcggctggcagcctgtgtgggcttccgcttcccgatcctgggtgtgcacctcaaggacctggtggccctgcagctggcactgcctgactggctggacccagcccggacccggctcaacggggccaagatgaagcagctctttagcatcctggaggagctggccatggtgaccagcctgcggccaccagtacaggccaaccccgacctgctgagcctgctcacggtgtctctggatcagtatcagacggaggatgagctgtaccagctgtccctgcagcgggagccgcgctccaagtcctcgccaaccagccccacgagttgcaccccaccaccccggcccccggtactggaggagtggacctcggctgccaaacccaagctggatcaggccctcgtggtggagcacatcgagaagatggtggagtctgtgttccggaactttgacgtcgatggggatggccacatctcacaggaagaattccagatcatccgtgggaacttcccttacctcagcgcctttggggacctcgaccagaaccaggatggctgcatcagcagggaggagatggtttcctatttcctgcgctccagctctgtgttgggggggcgcatgggcttcgtacacaacttccaggagagcaactccttgcgccccgtcgcctgccgccactgcaaagccctgatcctgggcatctacaagcagggcctcaaatgccgagcctgtggagtgaactgccacaagcagtgcaaggatcgcctgtcagttgagtgtcggcgcagggcccagagtgtgagcctggaggggtctgcaccctcaccctcacccatgcacagccaccatcaccgcgccttcagcttctctctgccccgccctggcaggcgaggctccaggcctccagagatccgtgaggaggaggtacagacggtggaggatggggtgtttgacatccacttgtaa
Sequence Length
1830
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
69,320 Da
NCBI Official Full Name
Homo sapiens RAS guanyl releasing protein 2 (calcium and DAG-regulated), mRNA
NCBI Official Synonym Full Names
RAS guanyl releasing protein 2
NCBI Official Symbol
RASGRP2
NCBI Official Synonym Symbols
CDC25L; CALDAG-GEFI
NCBI Protein Information
RAS guanyl-releasing protein 2
UniProt Protein Name
RAS guanyl-releasing protein 2
UniProt Gene Name
RASGRP2
UniProt Synonym Gene Names
CDC25L; MCG7; CalDAG-GEFI; hCDC25L
UniProt Entry Name
GRP2_HUMAN

NCBI Description

The protein encoded by this gene is a brain-enriched nucleotide exchanged factor that contains an N-terminal GEF domain, 2 tandem repeats of EF-hand calcium-binding motifs, and a C-terminal diacylglycerol/phorbol ester-binding domain. This protein can activate small GTPases, including RAS and RAP1/RAS3. The nucleotide exchange activity of this protein can be stimulated by calcium and diacylglycerol. Four alternatively spliced transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2016]

Uniprot Description

RASGRP2 iso2: Functions as a calcium- and DAG-regulated nucleotide exchange factor specifically activating Rap through the exchange of bound GDP for GTP. May also activates other GTPases such as RRAS, RRAS2, NRAS, KRAS but not HRAS. Functions in aggregation of platelets and adhesion of T-lymphocytes and neutrophils probably through inside-out integrin activation. May function in the muscarinic acetylcholine receptor M1/CHRM1 signaling pathway. Belongs to the RASGRP family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: GEFs; GEFs, Ras

Chromosomal Location of Human Ortholog: 11q13

Cellular Component: cytosol; plasma membrane

Molecular Function: calcium ion binding; guanyl-nucleotide exchange factor activity; lipid binding

Biological Process: positive regulation of GTPase activity; signal transduction

Disease: Bleeding Disorder, Platelet-type, 18

Research Articles on RASGRP2

Similar Products

Product Notes

The RASGRP2 rasgrp2 (Catalog #AAA1276108) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcaggca ccctggacct ggacaagggc tgcacggtgg aggagctgct ccgcgggtgc atcgaagcct tcgatgactc cgggaaggtg cgggacccgc agctggtgcg catgttcctc atgatgcacc cctggtacat cccctcctct cagctggcgg ccaagctgct ccacatctac caacaatccc ggaaggacaa ctccaattcc ctgcaggtga aaacgtgcca cctggtcagg tactggatct ccgccttccc agcggagttt gacttgaacc cggagttggc tgagcagatc aaggagctga aggctctgct agaccaagaa gggaaccgac ggcacagcag cctaatcgac atagacagcg tccctaccta caagtggaag cggcaggtga ctcagcggaa ccctgtggga cagaaaaagc gcaagatgtc cctgttgttt gaccacctgg agcccatgga gctggcggag catctcacct acttggagta tcgctccttc tgcaagatcc tgtttcagga ctatcacagt ttcgtgactc atggctgcac tgtggacaac cccgtcctgg agcggttcat ctccctcttc aacagcgtct cacagtgggt gcagctcatg atcctcagca aacccacagc cccgcagcgg gccctggtca tcacacactt tgtccacgtg gcggagaagc tgctacagct gcagaacttc aacacgctga tggcagtggt cgggggcctg agccacagct ccatctcccg cctcaaggag acccacagcc acgttagccc tgagaccatc aagctctggg agggtctcac ggaactagtg acggcgacag gcaactatgg caactaccgg cgtcggctgg cagcctgtgt gggcttccgc ttcccgatcc tgggtgtgca cctcaaggac ctggtggccc tgcagctggc actgcctgac tggctggacc cagcccggac ccggctcaac ggggccaaga tgaagcagct ctttagcatc ctggaggagc tggccatggt gaccagcctg cggccaccag tacaggccaa ccccgacctg ctgagcctgc tcacggtgtc tctggatcag tatcagacgg aggatgagct gtaccagctg tccctgcagc gggagccgcg ctccaagtcc tcgccaacca gccccacgag ttgcacccca ccaccccggc ccccggtact ggaggagtgg acctcggctg ccaaacccaa gctggatcag gccctcgtgg tggagcacat cgagaagatg gtggagtctg tgttccggaa ctttgacgtc gatggggatg gccacatctc acaggaagaa ttccagatca tccgtgggaa cttcccttac ctcagcgcct ttggggacct cgaccagaac caggatggct gcatcagcag ggaggagatg gtttcctatt tcctgcgctc cagctctgtg ttgggggggc gcatgggctt cgtacacaac ttccaggaga gcaactcctt gcgccccgtc gcctgccgcc actgcaaagc cctgatcctg ggcatctaca agcagggcct caaatgccga gcctgtggag tgaactgcca caagcagtgc aaggatcgcc tgtcagttga gtgtcggcgc agggcccaga gtgtgagcct ggaggggtct gcaccctcac cctcacccat gcacagccac catcaccgcg ccttcagctt ctctctgccc cgccctggca ggcgaggctc caggcctcca gagatccgtg aggaggaggt acagacggtg gaggatgggg tgtttgacat ccacttgtaa. It is sometimes possible for the material contained within the vial of "RASGRP2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.