Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RASA1 cdna clone

RASA1 cDNA Clone

Gene Names
RASA1; GAP; PKWS; RASA; p120; CMAVM; CM-AVM; RASGAP; p120GAP; p120RASGAP
Synonyms
RASA1; RASA1 cDNA Clone; RASA1 cdna clone
Ordering
For Research Use Only!
Sequence
atgatggcggccgaggccggcagtgaggagggcggcccggtaacagccggagctggaggaggcggcgcggcagcgggctccagtgcctatcccgcagtgtgtcgggtgaagatacccgcggccctgcctgtggcagccgccccctatcctgggctggtggagaccggagtggctggaactctgggtggcggagccgctttggggtcagagttcctaggagccgggtctgtggcaggggcactggggggagctggactgacagggggaggtactgctgctggcgtagctggtgctgctgctggcgtggccggtgctgctgttgctggacctagtggagacatggctctcaccaaactgcccacttcgttgcttgctgagactctcgggccaggcggcggttttccccctctgccccctcccccttacctgccccctttgggggcgggcctcgggacagtggacgaaggtgactctctggatggaccagaatacgaggaggaagaggtggccataccgttgaccgctcctccaactaaccagtggtatcacggaaaacttgacagaacgatagcagaagaacgcctcaggcaggcagggaagtctggcagttatcttataagagagagtgatcggaggccagggtcctttgtactttcatttcttagccagatgaatgttgtcaaccattttaggattattgctatgtgtggagattactacattggtggaagacgtttttcttcactgtcagacctaataggttattacagtcatgtttcttgtttgcttaaaggagaaaaattactttacccagttgcaccaccagagccagtagaagatagaaggcgtgtacgagctattctaccttacacaaaagtaccagacactgatgaaataagtttcttaaaaggagatatgttcattgttcataatgaattagaagatggatggatgtgggttacaaatttaagaacagatgaacaaggccttattgttgaagacctagtagaagaggtgggccgggaagaagatccacatgaaggaaaaatatggttccatgggaagatttccaaacaggaagcttataatttactaatgacagttggtcaagtctgcagttttcttgtgaggccctcagataatactcctggcgattattcactttatttccggaccaatgaaaatattcagcgatttaaaatatgtccaacgccaaacaatcagtttatgatgggaggccggtattataacagcattggggacatcatagatcactatcgaaaagaacagattgttgaaggatattatcttaaggaacctgtaccaatgcaggatcaagaacaagtactcaatgacacagtggatggcaaggaaatctataataccatccgtcgtaaaacaaaggatgccttttataaaaacattgttaagaaaggttatcttctgaaaaagggcaaaggaaaacgttggaaaaatttatattttatcttagagggtagtgatgcccaacttatttattttgaaagcgaaaaacgagctaccaaaccaaaaggattaatagatctcagtgtatgttctgtctatgtcgttcatgatagtctctttggcaggccaaactgttttcagatagtagttcagcactttagtgaagaacattacatcttttactttgcaggagaaactccagaacaagcagaggattggatgaaaggtctgcaggcattttgcaatttacggaaaagtagtccagggacatccaataaacgccttcgtcaggtcagcagccttgttttacatattgaagaagcccataaactcccagtaaaacattttactaatccatattgtaacatctacctgaatagtgtccaagtagcaaaaactcatgcaagggaagggcaaaacccagtatggtcagaagagtttgtctttgatgatcttcctcctgacatcaatagatttgaaataactcttagtaataaaacaaagaaaagcaaagatcctgatatcttatttatgcgctgccagttgagccgattacagaaagggcatgccacagatgaatggtttctgctcagctcccatataccattaaaaggtattgaaccagggtccctgcgtgttcgagcacgatactctatggaaaaaatcatgccagaagaagagtacagtgaatttaaagagcttatactgcaaaaggaacttcatgtagtctatgctttatcacatgtatgtggacaagaccgaacactactggccagcatcctactgaggatttttcttcacgaaaagcttgaatcgttgttgttatgcacactaaatgacagagaaataagcatggaagatgaagccactaccctatttcgagccacaacacttgcaagcaccttgatggagcagtatatgaaagccactgctacacagtttgttcatcatgctttgaaagactctattttaaagataatggaaagcaagcagtcttgtgagttaagtccatcaaagttagaaaaaaatgaagatgtgaacactaatttaacacacctattgaacatactttcagagcttgtggagaaaatattcatggcttcagaaatacttccaccgacattgagatatatttatgggtgtttacagaaatctgttcagcataagtggcctacaaataccaccatgagaacaagagttgttagtggttttgtttttcttcgactcatctgtcctgccatcctgaatccacggatgttcaatatcatctcagattctccatctcctattgctgcaagaacactgatattagtggctaaatctgtgcagaacttagcaaatcttgtggaatttggagctaaggagccctacatggaaggtgtcaatccattcatcaaaagcaacaaacatcgtatgatcatgtttttagatgaacttgggaatgtacctgaacttccggacactacagagcattctagaacggacctgtcccgtgatttagcagcattgcatgagatttgcgtggctcattcagatgaacttcgaacgctcagtaatgagcgtggtgcacagcagcacgtattgaaaaagcttctggctataacagaactgcttcaacaaaaacaaaaccagtatacaaaaaccaatgatgtcaggtag
Sequence Length
3144
Vector
pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
101,546 Da
NCBI Official Full Name
Homo sapiens RAS p21 protein activator (GTPase activating protein) 1, mRNA
NCBI Official Synonym Full Names
RAS p21 protein activator 1
NCBI Official Symbol
RASA1
NCBI Official Synonym Symbols
GAP; PKWS; RASA; p120; CMAVM; CM-AVM; RASGAP; p120GAP; p120RASGAP
NCBI Protein Information
ras GTPase-activating protein 1
UniProt Protein Name
Ras GTPase-activating protein 1
UniProt Gene Name
RASA1
UniProt Synonym Gene Names
GAP; RASA; GAP; GTPase-activating protein; RasGAP
UniProt Entry Name
RASA1_HUMAN

NCBI Description

The protein encoded by this gene is located in the cytoplasm and is part of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Mutations also have been associated with hereditary capillary malformations (CM) with or without arteriovenous malformations (AVM) and Parkes Weber syndrome. Alternative splicing results in two isoforms where the shorter isoform, lacking the N-terminal hydrophobic region but retaining the same activity, appears to be abundantly expressed in placental but not adult tissues. [provided by RefSeq, May 2012]

Uniprot Description

RASA1: a GTPase activator for normal RAS p21 but not its oncogenic counterpart, converting it to the putatively inactive GDP-bound state. Acting as a suppressor of RAS function, it enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Two alternatively spliced isoforms have been described.

Protein type: GAPs, Ras; GAPs; Motility/polarity/chemotaxis; Oncoprotein

Chromosomal Location of Human Ortholog: 5q13.3

Cellular Component: cytoplasm; cytosol

Molecular Function: glycoprotein binding; GTPase activator activity; GTPase binding; protein binding; receptor binding

Biological Process: blood vessel morphogenesis; cytokinesis after mitosis; embryonic development; ephrin receptor signaling pathway; MAPKKK cascade; negative regulation of cell adhesion; negative regulation of cell-matrix adhesion; negative regulation of neuron apoptosis; negative regulation of Ras protein signal transduction; regulation of actin filament polymerization; signal transduction; vasculogenesis

Disease: Basal Cell Carcinoma, Susceptibility To, 1; Capillary Malformation-arteriovenous Malformation; Parkes Weber Syndrome

Research Articles on RASA1

Similar Products

Product Notes

The RASA1 rasa1 (Catalog #AAA1266508) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatggcgg ccgaggccgg cagtgaggag ggcggcccgg taacagccgg agctggagga ggcggcgcgg cagcgggctc cagtgcctat cccgcagtgt gtcgggtgaa gatacccgcg gccctgcctg tggcagccgc cccctatcct gggctggtgg agaccggagt ggctggaact ctgggtggcg gagccgcttt ggggtcagag ttcctaggag ccgggtctgt ggcaggggca ctggggggag ctggactgac agggggaggt actgctgctg gcgtagctgg tgctgctgct ggcgtggccg gtgctgctgt tgctggacct agtggagaca tggctctcac caaactgccc acttcgttgc ttgctgagac tctcgggcca ggcggcggtt ttccccctct gccccctccc ccttacctgc cccctttggg ggcgggcctc gggacagtgg acgaaggtga ctctctggat ggaccagaat acgaggagga agaggtggcc ataccgttga ccgctcctcc aactaaccag tggtatcacg gaaaacttga cagaacgata gcagaagaac gcctcaggca ggcagggaag tctggcagtt atcttataag agagagtgat cggaggccag ggtcctttgt actttcattt cttagccaga tgaatgttgt caaccatttt aggattattg ctatgtgtgg agattactac attggtggaa gacgtttttc ttcactgtca gacctaatag gttattacag tcatgtttct tgtttgctta aaggagaaaa attactttac ccagttgcac caccagagcc agtagaagat agaaggcgtg tacgagctat tctaccttac acaaaagtac cagacactga tgaaataagt ttcttaaaag gagatatgtt cattgttcat aatgaattag aagatggatg gatgtgggtt acaaatttaa gaacagatga acaaggcctt attgttgaag acctagtaga agaggtgggc cgggaagaag atccacatga aggaaaaata tggttccatg ggaagatttc caaacaggaa gcttataatt tactaatgac agttggtcaa gtctgcagtt ttcttgtgag gccctcagat aatactcctg gcgattattc actttatttc cggaccaatg aaaatattca gcgatttaaa atatgtccaa cgccaaacaa tcagtttatg atgggaggcc ggtattataa cagcattggg gacatcatag atcactatcg aaaagaacag attgttgaag gatattatct taaggaacct gtaccaatgc aggatcaaga acaagtactc aatgacacag tggatggcaa ggaaatctat aataccatcc gtcgtaaaac aaaggatgcc ttttataaaa acattgttaa gaaaggttat cttctgaaaa agggcaaagg aaaacgttgg aaaaatttat attttatctt agagggtagt gatgcccaac ttatttattt tgaaagcgaa aaacgagcta ccaaaccaaa aggattaata gatctcagtg tatgttctgt ctatgtcgtt catgatagtc tctttggcag gccaaactgt tttcagatag tagttcagca ctttagtgaa gaacattaca tcttttactt tgcaggagaa actccagaac aagcagagga ttggatgaaa ggtctgcagg cattttgcaa tttacggaaa agtagtccag ggacatccaa taaacgcctt cgtcaggtca gcagccttgt tttacatatt gaagaagccc ataaactccc agtaaaacat tttactaatc catattgtaa catctacctg aatagtgtcc aagtagcaaa aactcatgca agggaagggc aaaacccagt atggtcagaa gagtttgtct ttgatgatct tcctcctgac atcaatagat ttgaaataac tcttagtaat aaaacaaaga aaagcaaaga tcctgatatc ttatttatgc gctgccagtt gagccgatta cagaaagggc atgccacaga tgaatggttt ctgctcagct cccatatacc attaaaaggt attgaaccag ggtccctgcg tgttcgagca cgatactcta tggaaaaaat catgccagaa gaagagtaca gtgaatttaa agagcttata ctgcaaaagg aacttcatgt agtctatgct ttatcacatg tatgtggaca agaccgaaca ctactggcca gcatcctact gaggattttt cttcacgaaa agcttgaatc gttgttgtta tgcacactaa atgacagaga aataagcatg gaagatgaag ccactaccct atttcgagcc acaacacttg caagcacctt gatggagcag tatatgaaag ccactgctac acagtttgtt catcatgctt tgaaagactc tattttaaag ataatggaaa gcaagcagtc ttgtgagtta agtccatcaa agttagaaaa aaatgaagat gtgaacacta atttaacaca cctattgaac atactttcag agcttgtgga gaaaatattc atggcttcag aaatacttcc accgacattg agatatattt atgggtgttt acagaaatct gttcagcata agtggcctac aaataccacc atgagaacaa gagttgttag tggttttgtt tttcttcgac tcatctgtcc tgccatcctg aatccacgga tgttcaatat catctcagat tctccatctc ctattgctgc aagaacactg atattagtgg ctaaatctgt gcagaactta gcaaatcttg tggaatttgg agctaaggag ccctacatgg aaggtgtcaa tccattcatc aaaagcaaca aacatcgtat gatcatgttt ttagatgaac ttgggaatgt acctgaactt ccggacacta cagagcattc tagaacggac ctgtcccgtg atttagcagc attgcatgag atttgcgtgg ctcattcaga tgaacttcga acgctcagta atgagcgtgg tgcacagcag cacgtattga aaaagcttct ggctataaca gaactgcttc aacaaaaaca aaaccagtat acaaaaacca atgatgtcag gtag. It is sometimes possible for the material contained within the vial of "RASA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.