Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RARB cdna clone

RARB cDNA Clone

Gene Names
RARB; HAP; RRB2; NR1B2; MCOPS12; RARbeta1
Synonyms
RARB; RARB cDNA Clone; RARB cdna clone
Ordering
For Research Use Only!
Sequence
atgtttgactgtatggatgttctgtcagtgagtcctgggcaaatcctggatttctacactgcgagtccgtcttcctgcatgctccaggagaaagctctcaaagcatgcttcagtggattgacccaaaccgaatggcagcatcggcacactgctcaatcaattgaaacacagagcaccagctctgaggaactcgtcccaagccccccatctccacttcctccccctcgagtgtacaaaccctgcttcgtctgccaggacaaatcatcagggtaccactatggggtcagcgcctgtgagggatgtaagggctttttccgcagaagtattcagaagaatatgatttacacttgtcaccgagataagaactgtgttattaataaagtcaccaggaatcgatgccaatactgtcgactccagaagtgctttgaagtgggaatgtccaaagaatctgtcaggaatgacaggaacaagaaaaagaaggagacttcgaagcaagaatgcacagagagctatgaaatgacagctgagttggacgatctcacagagaagatccgaaaagctcaccaggaaactttcccttcactctgccagctgggtaaatacaccacgaattccagtgctgaccatcgagtccgactggacctgggcctctgggacaaattcagtgaactggccaccaagtgcattattaagatcgtggagtttgctaaacgtctgcctggtttcactggcttgaccatcgcagaccaaattaccctgctgaaggccgcctgcctggacatcctgattcttagaatttgcaccaggtataccccagaacaagacaccatgactttctcagacggccttaccctaaatcgaactcagatgcacaatgctggatttggtcctctgactgaccttgtgttcacctttgccaaccagctcctgcctttggaaatggatgacacagaaacaggccttctcagtgccatctgcttaatctgtggagaccgccaggaccttgaggaaccgacaaaagtagataagctacaagaaccattgctggaagcactaaaaatttatatcagaaaaagacgacccagcaagcctcacatgtttccaaagatcttaatgaaaatcacagatctccgtagcatcagtgctaaaggtgcagagcgtgtaattaccttgaaaatggaaattcctggatcaatgccacctctcattcaagaaatgctggagaattctgaaggacatgaacccttgaccccaagttcaagtgggaacacagcagagcacagtcctagcatctcacccagctcagtggaaaacagtggggtcagtcagtcaccactcgtgcaataa
Sequence Length
1347
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
– Da
NCBI Official Full Name
Homo sapiens retinoic acid receptor, beta, mRNA
NCBI Official Synonym Full Names
retinoic acid receptor beta
NCBI Official Symbol
RARB
NCBI Official Synonym Symbols
HAP; RRB2; NR1B2; MCOPS12; RARbeta1
NCBI Protein Information
retinoic acid receptor beta
UniProt Protein Name
Retinoic acid receptor beta
Protein Family
UniProt Gene Name
RARB
UniProt Synonym Gene Names
HAP; NR1B2; RAR-beta
UniProt Entry Name
RARB_HUMAN

NCBI Description

This gene encodes retinoic acid receptor beta, a member of the thyroid-steroid hormone receptor superfamily of nuclear transcriptional regulators. This receptor localizes to the cytoplasm and to subnuclear compartments. It binds retinoic acid, the biologically active form of vitamin A which mediates cellular signalling in embryonic morphogenesis, cell growth and differentiation. It is thought that this protein limits growth of many cell types by regulating gene expression. The gene was first identified in a hepatocellular carcinoma where it flanks a hepatitis B virus integration site. Alternate promoter usage and differential splicing result in multiple transcript variants. [provided by RefSeq, Mar 2014]

Uniprot Description

RARB: is a receptor for retinoic acid, a potent mammalian morphogen and teratogen that has profound effects on vertebrate development. RARB is a member of the nuclear receptor superfamily. Controls cell function by directly regulating gene expression. Composed of three domains: a modulating N-terminal domain, a DNA-binding domain and a C-terminal steroid-binding domain. Four splice-variant isoforms have been described. Isoform beta-1 and beta-2 are nuclear and isoform beta-4 cytoplasmic.

Protein type: Nuclear receptor; Oncoprotein; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 3p24.2

Cellular Component: nucleoplasm; nucleus

Molecular Function: DNA binding

Biological Process: embryonic gut development; signal transduction; transcription initiation from RNA polymerase II promoter

Disease: Microphthalmia, Syndromic 12

Research Articles on RARB

Similar Products

Product Notes

The RARB rarb (Catalog #AAA1273752) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtttgact gtatggatgt tctgtcagtg agtcctgggc aaatcctgga tttctacact gcgagtccgt cttcctgcat gctccaggag aaagctctca aagcatgctt cagtggattg acccaaaccg aatggcagca tcggcacact gctcaatcaa ttgaaacaca gagcaccagc tctgaggaac tcgtcccaag ccccccatct ccacttcctc cccctcgagt gtacaaaccc tgcttcgtct gccaggacaa atcatcaggg taccactatg gggtcagcgc ctgtgaggga tgtaagggct ttttccgcag aagtattcag aagaatatga tttacacttg tcaccgagat aagaactgtg ttattaataa agtcaccagg aatcgatgcc aatactgtcg actccagaag tgctttgaag tgggaatgtc caaagaatct gtcaggaatg acaggaacaa gaaaaagaag gagacttcga agcaagaatg cacagagagc tatgaaatga cagctgagtt ggacgatctc acagagaaga tccgaaaagc tcaccaggaa actttccctt cactctgcca gctgggtaaa tacaccacga attccagtgc tgaccatcga gtccgactgg acctgggcct ctgggacaaa ttcagtgaac tggccaccaa gtgcattatt aagatcgtgg agtttgctaa acgtctgcct ggtttcactg gcttgaccat cgcagaccaa attaccctgc tgaaggccgc ctgcctggac atcctgattc ttagaatttg caccaggtat accccagaac aagacaccat gactttctca gacggcctta ccctaaatcg aactcagatg cacaatgctg gatttggtcc tctgactgac cttgtgttca cctttgccaa ccagctcctg cctttggaaa tggatgacac agaaacaggc cttctcagtg ccatctgctt aatctgtgga gaccgccagg accttgagga accgacaaaa gtagataagc tacaagaacc attgctggaa gcactaaaaa tttatatcag aaaaagacga cccagcaagc ctcacatgtt tccaaagatc ttaatgaaaa tcacagatct ccgtagcatc agtgctaaag gtgcagagcg tgtaattacc ttgaaaatgg aaattcctgg atcaatgcca cctctcattc aagaaatgct ggagaattct gaaggacatg aacccttgac cccaagttca agtgggaaca cagcagagca cagtcctagc atctcaccca gctcagtgga aaacagtggg gtcagtcagt caccactcgt gcaataa. It is sometimes possible for the material contained within the vial of "RARB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.