Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAP1B cdna clone

RAP1B cDNA Clone

Gene Names
RAP1B; K-REV; RAL1B
Synonyms
RAP1B; RAP1B cDNA Clone; RAP1B cdna clone
Ordering
For Research Use Only!
Sequence
atgcgtgagtataagctagtcgttcttggctcaggaggcgttggaaagtctgctttgactgtacaatttgttcaaggaatttttgtagaaaaatacgatcctacgatagaagattcttatagaaagcaagttgaagtagatgcacaacagtgtatgcttgaaatcttggatactgcaggaacggagcaatttacagcaatgagggatttatacatgaaaaatggacaaggatttgcattagtttattccatcacagcacagtccacatttaacgatttacaagacctgagagaacagattcttcgagttaaagacactgatgatgttccaatgattcttgttggtaataagtgtgacttggaagatgaaagagttgtagggaaggaacaaggtcaaaatctagcaagacaatggaacaactgtgcattcttagaatcttctgcaaaatcaaaaataaatgttaatgagatcttttatgacctagtgcggcaaattaacagaaaaactccagtgcctgggaaggctcgcaaaaagtcatcatgtcagctgctttaa
Sequence Length
555
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,033 Da
NCBI Official Full Name
Homo sapiens RAP1B, member of RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAP1B, member of RAS oncogene family
NCBI Official Symbol
RAP1B
NCBI Official Synonym Symbols
K-REV; RAL1B
NCBI Protein Information
ras-related protein Rap-1b
UniProt Protein Name
Ras-related protein Rap-1b
Protein Family
UniProt Gene Name
RAP1B
UniProt Entry Name
RAP1B_HUMAN

NCBI Description

This gene encodes a member of the RAS-like small GTP-binding protein superfamily. Members of this family regulate multiple cellular processes including cell adhesion and growth and differentiation. This protein localizes to cellular membranes and has been shown to regulate integrin-mediated cell signaling. This protein also plays a role in regulating outside-in signaling in platelets. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 3, 5, 6 and 9. [provided by RefSeq, Oct 2011]

Uniprot Description

RAP1B: GTP-binding protein that possesses intrinsic GTPase activity. Contributes to the polarizing activity of KRIT1 and CDH5 in the establishment and maintenance of correct endothelial cell polarity and vascular lumen. Required for the localization of phosphorylated PRKCZ, PARD3 and TIAM1 to the cell junction. Heterodimer with RAP1GAP. Interacts with EPAC2, SGSM1, SGSM2 and SGSM3. Activated by binding to the GTPase-activating protein RAP1GAP. Activated by guanine nucleotide-exchange factor (GEF) EPAC2 in a cAMP-dependent manner. Belongs to the small GTPase superfamily. Ras family.

Protein type: G protein, monomeric; G protein, monomeric, Ras; G protein

Chromosomal Location of Human Ortholog: 12q14

Cellular Component: cytosol; intercellular junction; intracellular; lipid particle; lipid raft; membrane; plasma membrane

Molecular Function: GDP binding; GTP binding; GTPase activity; protein binding; protein complex binding

Biological Process: microvillus biogenesis; Rap protein signal transduction

Research Articles on RAP1B

Similar Products

Product Notes

The RAP1B rap1b (Catalog #AAA1272755) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcgtgagt ataagctagt cgttcttggc tcaggaggcg ttggaaagtc tgctttgact gtacaatttg ttcaaggaat ttttgtagaa aaatacgatc ctacgataga agattcttat agaaagcaag ttgaagtaga tgcacaacag tgtatgcttg aaatcttgga tactgcagga acggagcaat ttacagcaat gagggattta tacatgaaaa atggacaagg atttgcatta gtttattcca tcacagcaca gtccacattt aacgatttac aagacctgag agaacagatt cttcgagtta aagacactga tgatgttcca atgattcttg ttggtaataa gtgtgacttg gaagatgaaa gagttgtagg gaaggaacaa ggtcaaaatc tagcaagaca atggaacaac tgtgcattct tagaatcttc tgcaaaatca aaaataaatg ttaatgagat cttttatgac ctagtgcggc aaattaacag aaaaactcca gtgcctggga aggctcgcaa aaagtcatca tgtcagctgc tttaa. It is sometimes possible for the material contained within the vial of "RAP1B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.