Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RALB cdna clone

RALB cDNA Clone

Synonyms
RALB; RALB cDNA Clone; RALB cdna clone
Ordering
For Research Use Only!
Sequence
atggctgccaacaagagtaagggccagagctccttggccctccacaaggtgatcatggttggcagcggaggcgttggcaagtcagccctgacgcttcagttcatgtatgacgagtttgtagaagactatgaacctaccaaagctgacagttatagaaagaaagtggttcttgatggggaagaagttcagatagatattctggacaccgctgggcaagaggactacgcagccattcgagataactactttcggagtggggaagggtttcttcttgtgttctcaatcacagaacatgaatcctttacagcaactgccgaattcagggaacagattctccgtgtgaaggctgaagaagataaaattccactgctcgtcgtgggaaacaagtctgacctagaggagcggaggcaggtgcctgtggaggaggccaggagtaaagccgaagagtggggcgtgcagtacgtggagacgtcagcgaagacccgggccaacgtggacaaggtgttctttgacctaatgagagaaatcagaacaaagaagatgtcagaaaacaaagacaagaatggcaagaaaagcagcaagaacaagaaaagttttaaagaaagatgttgcttactatga
Sequence Length
621
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
25,710 Da
NCBI Official Full Name
Homo sapiens v-ral simian leukemia viral oncogene homolog B (ras related; GTP binding protein), mRNA
NCBI Official Synonym Full Names
RAS like proto-oncogene B
NCBI Official Symbol
RALB
NCBI Protein Information
ras-related protein Ral-B
UniProt Protein Name
Ras-related protein Ral-B
Protein Family
UniProt Gene Name
RALB
UniProt Entry Name
RALB_HUMAN

NCBI Description

This gene encodes a GTP-binding protein that belongs to the small GTPase superfamily and Ras family of proteins. GTP-binding proteins mediate the transmembrane signaling initiated by the occupancy of certain cell surface receptors. [provided by RefSeq, Jul 2008]

Uniprot Description

RALB: Multifuntional GTPase involved in a variety of cellular processes including gene expression, cell migration, cell proliferation, oncogenic transformation and membrane trafficking. Accomplishes its multiple functions by interacting with distinct downstream effectors. Acts as a GTP sensor for GTP-dependent exocytosis of dense core vesicles. Required both to stabilize the assembly of the exocyst complex and to localize functional exocyst complexes to the leading edge of migrating cells. Plays a role in the late stages of cytokinesis and is required for the abscission of the bridge joining the sister cells emerging from mitosis. Required for suppression of apoptosis. Interacts with EXOC2 and EXOC8. Interacts with RALBP1 via its effector domain. Alternate between an inactive form bound to GDP and an active form bound to GTP. Activated by a guanine nucleotide-exchange factor (GEF) and inactivated by a GTPase- activating protein (GAP). Belongs to the small GTPase superfamily. Ras family.

Protein type: G protein, monomeric; G protein; G protein, monomeric, Ras

Chromosomal Location of Human Ortholog: 2q14.2

Cellular Component: autophagic vacuole; exocyst; midbody; plasma membrane

Molecular Function: ATPase binding; GDP binding; GTP binding; GTPase activity; protein binding; ubiquitin protein ligase binding

Biological Process: cellular response to starvation; cytokinesis; negative regulation of protein binding; positive regulation of protein amino acid phosphorylation; positive regulation of protein binding; regulation of exocyst assembly; regulation of exocyst localization; signal transduction

Research Articles on RALB

Similar Products

Product Notes

The RALB ralb (Catalog #AAA1275753) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctgcca acaagagtaa gggccagagc tccttggccc tccacaaggt gatcatggtt ggcagcggag gcgttggcaa gtcagccctg acgcttcagt tcatgtatga cgagtttgta gaagactatg aacctaccaa agctgacagt tatagaaaga aagtggttct tgatggggaa gaagttcaga tagatattct ggacaccgct gggcaagagg actacgcagc cattcgagat aactactttc ggagtgggga agggtttctt cttgtgttct caatcacaga acatgaatcc tttacagcaa ctgccgaatt cagggaacag attctccgtg tgaaggctga agaagataaa attccactgc tcgtcgtggg aaacaagtct gacctagagg agcggaggca ggtgcctgtg gaggaggcca ggagtaaagc cgaagagtgg ggcgtgcagt acgtggagac gtcagcgaag acccgggcca acgtggacaa ggtgttcttt gacctaatga gagaaatcag aacaaagaag atgtcagaaa acaaagacaa gaatggcaag aaaagcagca agaacaagaa aagttttaaa gaaagatgtt gcttactatg a. It is sometimes possible for the material contained within the vial of "RALB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.