Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAB22A cdna clone

RAB22A cDNA Clone

Synonyms
RAB22A; RAB22A cDNA Clone; RAB22A cdna clone
Ordering
For Research Use Only!
Sequence
atggcgctgagggagctcaaagtgtgtctgctcggggatacaggtgtaggtaaatcgagtattgtgtggcggtttgtggaagacagttttgatccaaacatcaacccaacaataggggcatcttttatgaccaagactgtccagtaccaaaatgagctacataaattcctaatctgggatacagctggacaagaacgatttcgtgccttagcaccaatgtactatcgagggtcggctgcagctataatcgtttatgatatcacaaaagaagagacattttcaacattaaagaattgggtgaaagagcttcgacagcatggcccacctaatattgtagttgccattgcaggaaataaatgtgatcttatcgatgtaagagaagtcatggagagagatgcaaaggactacgccgactctattcatgcaatttttgtagagaccagcgcaaaaaacgcgataaacataaatgaactctttatagaaattagtcgaagaattccatccactgacgccaacctgccatctggcggtaagggcttcaaactccgaagacagccttcagagccaaagcggagctgctgctga
Sequence Length
585
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
21,855 Da
NCBI Official Full Name
Homo sapiens RAB22A, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB22A, member RAS oncogene family
NCBI Official Symbol
RAB22A
NCBI Protein Information
ras-related protein Rab-22A
UniProt Protein Name
Ras-related protein Rab-22A
Protein Family
UniProt Gene Name
RAB22A
UniProt Synonym Gene Names
RAB22; Rab-22
UniProt Entry Name
RB22A_HUMAN

NCBI Description

The protein encoded by this gene is a member of the RAB family of small GTPases. The GTP-bound form of the encoded protein has been shown to interact with early-endosomal antigen 1, and may be involved in the trafficking of and interaction between endosomal compartments. [provided by RefSeq, Jul 2008]

Uniprot Description

RAB22A: is a member of the RAB family of small GTPases. The GTP-bound form of the encoded protein has been shown to interact with early-endosomal antigen 1, and may be involved in the trafficking of and interaction between endosomal compartments. [provided by RefSeq, Jul 2008]

Protein type: G protein, monomeric; G protein; G protein, monomeric, Rab

Chromosomal Location of Human Ortholog: 20q13.32

Cellular Component: early endosome; phagocytic vesicle; plasma membrane

Molecular Function: GDP binding; GTP binding; GTPase activity; protein binding

Biological Process: endocytosis; endosome organization and biogenesis

Research Articles on RAB22A

Similar Products

Product Notes

The RAB22A rab22a (Catalog #AAA1276656) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgctga gggagctcaa agtgtgtctg ctcggggata caggtgtagg taaatcgagt attgtgtggc ggtttgtgga agacagtttt gatccaaaca tcaacccaac aataggggca tcttttatga ccaagactgt ccagtaccaa aatgagctac ataaattcct aatctgggat acagctggac aagaacgatt tcgtgcctta gcaccaatgt actatcgagg gtcggctgca gctataatcg tttatgatat cacaaaagaa gagacatttt caacattaaa gaattgggtg aaagagcttc gacagcatgg cccacctaat attgtagttg ccattgcagg aaataaatgt gatcttatcg atgtaagaga agtcatggag agagatgcaa aggactacgc cgactctatt catgcaattt ttgtagagac cagcgcaaaa aacgcgataa acataaatga actctttata gaaattagtc gaagaattcc atccactgac gccaacctgc catctggcgg taagggcttc aaactccgaa gacagccttc agagccaaag cggagctgct gctga. It is sometimes possible for the material contained within the vial of "RAB22A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.