Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

QRICH1 cdna clone

QRICH1 cDNA Clone

Synonyms
QRICH1; QRICH1 cDNA Clone; QRICH1 cdna clone
Ordering
For Research Use Only!
Sequence
atgaataattccctagagaacaccatctcctttgaagagtacatccgagtaaaggcacggtctgtcccgcaacacaggatgaaggaatttctggactcactggcctctaaggggccagaagcccttcaggagttccagcagacagccaccactaccatggtgtaccaacagggtgggaactgcatatacacagacagcactgaagtggctgggtctttgcttgaacttgcctgtccagtcaccaccagtgttcagccacaaacccagcaagaacagcagatccaggttcagcagccgcagcaggttcaggtccaggtgcaggtacagcagtctccgcaacaggtctcggctcagctctccccacaactcaccgttcaccagcctactgagcaacccatccaggtccaggtgcagatccaaggccaggcaccacagtcagcagccccctccattcagaccccgtctctgcagagtcccagtccctcgcagctgcaagcagctcagatccaggtgcagcacgtgcaagcagcccagcagatccaggctgcagaaatcccggaggagcacatcccacatcagcaaatccaggctcagctggtggctggccagtctcttgctggtggtcagcagatccaaatccagaccgtgggtgccctttccccaccaccatcccagcagggctcaccccgggaaggggagcggcgggttggcacggccagtgtcctccaaccagtgaagaagcgcaaagtggacatgcccatcactgtgtcctacgccatctcagggcagccggtggccaccgtgctggccattccacagggccagcagcagagttatgtgtctttgaggccagacttactgacagtagacagtgcccacctgtacagtgccactgggaccattactagccctacaggagaaacctggaccatccctgtttattctgcccagccccggggggaccctcagcagcagagcattacccacattgccattccccaggaagcctacaacgcagttcacgtcagtggctcacccacagccctggcagctgttaagctggaggatgacaaggagaagatggtgggcaccacatctgtagtgaaaaactcccatgaagaggtagtgcagacccttgcaaactctctctttccagcacagttcatgaatggcaacatccacattccagtggctgtgcaggctgtggcaggcacgtaccagaatacggctcaaactgtccatatatgggacccccaacagcagccgcagcagcaaactccccaggaacagacaccaccaccacagcagcagcagcagcaactccaagttacttgttcagctcaaactgtccaggttgctgaagttgaaccacagtcacagccacagccttccccagaacttctgcttccaaattctttgaagccagaagaagggcttgaagtatggaaaaactgggcccagaccaagaatgctgaactagagaaggatgctcagaacagattggcacccattgggaggcgccaactgctgcgattccaggaagatctcatctcctctgctgtggcagagttgaattatgggctctgtctaatgacacgggaagctcgaaatggagaaggtgaaccctatgacccagatgtgctctactatattttcctgtgtattcaaaagtatctttttgaaaatggaagggtagatgacattttctccgatctttattatgttcggttcacggagtggctacatgaagttctgaaggatgttcagccccgggtcactccacttggctatgtcttgcccagccacgtgactgaggagatgctatgggagtgcaagcagcttggggctcactccccctccaccttgctgaccaccctcatgttctttaataccaagtacttcctattgaagacagtggaccagcacatgaagctggccttctccaaggtcttgcgacagacaaagaagaacccctctaatcccaaggataaaagcacgagtatccggtacttgaaggcccttggaatacaccagactggccagaaagttacagatgacatgtatgcagaacagacggaaaatccagagaatccattgagatgtcccatcaagctctatgatttctacctcttcaaatgcccccagagtgtgaaaggccggaatgacaccttttacctgacacctgagccagtggtggcccccaacagcccaatctggtactcagtccagcctatcagcagagagcagatgggacaaatgctgacgcggatcctggtgataagagaaattcaggaggccatcgcagtggccaatgcaagcactatgcactga
Sequence Length
2331
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
86,436 Da
NCBI Official Full Name
Homo sapiens glutamine-rich 1, mRNA
NCBI Official Synonym Full Names
glutamine rich 1
NCBI Official Symbol
QRICH1
NCBI Protein Information
glutamine-rich protein 1
UniProt Protein Name
Glutamine-rich protein 1
Protein Family
UniProt Gene Name
QRICH1
UniProt Entry Name
QRIC1_HUMAN

Uniprot Description

QRICH1:

Protein type: Unknown function

Chromosomal Location of Human Ortholog: 3p21.31

Cellular Component: cytoplasm; nucleoplasm

Molecular Function: DNA binding; protein binding

Biological Process: cytoskeleton organization and biogenesis; multicellular organismal development; regulation of cell morphogenesis

Similar Products

Product Notes

The QRICH1 qrich1 (Catalog #AAA1274675) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaataatt ccctagagaa caccatctcc tttgaagagt acatccgagt aaaggcacgg tctgtcccgc aacacaggat gaaggaattt ctggactcac tggcctctaa ggggccagaa gcccttcagg agttccagca gacagccacc actaccatgg tgtaccaaca gggtgggaac tgcatataca cagacagcac tgaagtggct gggtctttgc ttgaacttgc ctgtccagtc accaccagtg ttcagccaca aacccagcaa gaacagcaga tccaggttca gcagccgcag caggttcagg tccaggtgca ggtacagcag tctccgcaac aggtctcggc tcagctctcc ccacaactca ccgttcacca gcctactgag caacccatcc aggtccaggt gcagatccaa ggccaggcac cacagtcagc agccccctcc attcagaccc cgtctctgca gagtcccagt ccctcgcagc tgcaagcagc tcagatccag gtgcagcacg tgcaagcagc ccagcagatc caggctgcag aaatcccgga ggagcacatc ccacatcagc aaatccaggc tcagctggtg gctggccagt ctcttgctgg tggtcagcag atccaaatcc agaccgtggg tgccctttcc ccaccaccat cccagcaggg ctcaccccgg gaaggggagc ggcgggttgg cacggccagt gtcctccaac cagtgaagaa gcgcaaagtg gacatgccca tcactgtgtc ctacgccatc tcagggcagc cggtggccac cgtgctggcc attccacagg gccagcagca gagttatgtg tctttgaggc cagacttact gacagtagac agtgcccacc tgtacagtgc cactgggacc attactagcc ctacaggaga aacctggacc atccctgttt attctgccca gccccggggg gaccctcagc agcagagcat tacccacatt gccattcccc aggaagccta caacgcagtt cacgtcagtg gctcacccac agccctggca gctgttaagc tggaggatga caaggagaag atggtgggca ccacatctgt agtgaaaaac tcccatgaag aggtagtgca gacccttgca aactctctct ttccagcaca gttcatgaat ggcaacatcc acattccagt ggctgtgcag gctgtggcag gcacgtacca gaatacggct caaactgtcc atatatggga cccccaacag cagccgcagc agcaaactcc ccaggaacag acaccaccac cacagcagca gcagcagcaa ctccaagtta cttgttcagc tcaaactgtc caggttgctg aagttgaacc acagtcacag ccacagcctt ccccagaact tctgcttcca aattctttga agccagaaga agggcttgaa gtatggaaaa actgggccca gaccaagaat gctgaactag agaaggatgc tcagaacaga ttggcaccca ttgggaggcg ccaactgctg cgattccagg aagatctcat ctcctctgct gtggcagagt tgaattatgg gctctgtcta atgacacggg aagctcgaaa tggagaaggt gaaccctatg acccagatgt gctctactat attttcctgt gtattcaaaa gtatcttttt gaaaatggaa gggtagatga cattttctcc gatctttatt atgttcggtt cacggagtgg ctacatgaag ttctgaagga tgttcagccc cgggtcactc cacttggcta tgtcttgccc agccacgtga ctgaggagat gctatgggag tgcaagcagc ttggggctca ctccccctcc accttgctga ccaccctcat gttctttaat accaagtact tcctattgaa gacagtggac cagcacatga agctggcctt ctccaaggtc ttgcgacaga caaagaagaa cccctctaat cccaaggata aaagcacgag tatccggtac ttgaaggccc ttggaataca ccagactggc cagaaagtta cagatgacat gtatgcagaa cagacggaaa atccagagaa tccattgaga tgtcccatca agctctatga tttctacctc ttcaaatgcc cccagagtgt gaaaggccgg aatgacacct tttacctgac acctgagcca gtggtggccc ccaacagccc aatctggtac tcagtccagc ctatcagcag agagcagatg ggacaaatgc tgacgcggat cctggtgata agagaaattc aggaggccat cgcagtggcc aatgcaagca ctatgcactg a. It is sometimes possible for the material contained within the vial of "QRICH1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.