Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PVRIG cdna clone

PVRIG cDNA Clone

Gene Names
PVRIG; CD112R; C7orf15
Synonyms
PVRIG; PVRIG cDNA Clone; PVRIG cdna clone
Ordering
For Research Use Only!
Sequence
atgagaacagaggcacaggtgccggccctgcagcccccagaacctggactggagggggccatggggcaccggaccctggtcctgccctgggtgctgctgaccttgtgtgtcactgcggggaccccggaggtgtgggttcaagttcggatggaggccaccgagctctcgtccttcaccatccgttgtgggttcctggggtctggctccatctccctggtgactgtgagctgggggggccccgacggtgctggggggaccacgctggctgtgttgcacccagaacgtggcatccggcaatgggcccctgctcgccaggcccgctgggaaacccagagcagcatctctctcatcctggaaggctctggggccagcagcccctgcgccaacaccaccttctgctgcaagtttgcgtccttccctgagggctcctgggaggcctgtgggagcctcccgcccagctcagacccagggctctctgccccgccgactcctgcccccattctgcgggcagacctggccgggatcttgggggtctcaggagtcctcctctttggctgtgtctacctccttcatctgctgcgccgacataagcaccgccctgcccctaggctccagccgtcccgcaccagcccccaggcaccgagagcacgagcatgggcaccaagccaggcctcccaggctgctcttcacgtcccttatgccactatcaacaccagctgccgcccagctactttggacacagctcacccccatggggggccgtcctggtgggcgtcactccccacccacgctgcacaccggccccagggccctgccgcctgggcctccacacccatccctgcacgtggcagctttgtctctgttgagaatggactctacgctcaggcaggggagaggcctcctcacactggtcccggcctcactcttttccctgaccctcgggggcccagggccatggaaggacccttaggagttcgatga
Sequence Length
981
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,344 Da
NCBI Official Full Name
Homo sapiens poliovirus receptor related immunoglobulin domain containing, mRNA
NCBI Official Synonym Full Names
poliovirus receptor related immunoglobulin domain containing
NCBI Official Symbol
PVRIG
NCBI Official Synonym Symbols
CD112R; C7orf15
NCBI Protein Information
transmembrane protein PVRIG
UniProt Protein Name
Transmembrane protein PVRIG
Protein Family
UniProt Gene Name
PVRIG
UniProt Synonym Gene Names
C7orf15
UniProt Entry Name
PVRIG_HUMAN

Uniprot Description

PVRIG:

Protein type: Membrane protein, integral; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 7q22.1

Research Articles on PVRIG

Similar Products

Product Notes

The PVRIG pvrig (Catalog #AAA1275985) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagaacag aggcacaggt gccggccctg cagcccccag aacctggact ggagggggcc atggggcacc ggaccctggt cctgccctgg gtgctgctga ccttgtgtgt cactgcgggg accccggagg tgtgggttca agttcggatg gaggccaccg agctctcgtc cttcaccatc cgttgtgggt tcctggggtc tggctccatc tccctggtga ctgtgagctg ggggggcccc gacggtgctg gggggaccac gctggctgtg ttgcacccag aacgtggcat ccggcaatgg gcccctgctc gccaggcccg ctgggaaacc cagagcagca tctctctcat cctggaaggc tctggggcca gcagcccctg cgccaacacc accttctgct gcaagtttgc gtccttccct gagggctcct gggaggcctg tgggagcctc ccgcccagct cagacccagg gctctctgcc ccgccgactc ctgcccccat tctgcgggca gacctggccg ggatcttggg ggtctcagga gtcctcctct ttggctgtgt ctacctcctt catctgctgc gccgacataa gcaccgccct gcccctaggc tccagccgtc ccgcaccagc ccccaggcac cgagagcacg agcatgggca ccaagccagg cctcccaggc tgctcttcac gtcccttatg ccactatcaa caccagctgc cgcccagcta ctttggacac agctcacccc catggggggc cgtcctggtg ggcgtcactc cccacccacg ctgcacaccg gccccagggc cctgccgcct gggcctccac acccatccct gcacgtggca gctttgtctc tgttgagaat ggactctacg ctcaggcagg ggagaggcct cctcacactg gtcccggcct cactcttttc cctgaccctc gggggcccag ggccatggaa ggacccttag gagttcgatg a. It is sometimes possible for the material contained within the vial of "PVRIG, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.