Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSRC1 cdna clone

PSRC1 cDNA Clone

Gene Names
PSRC1; DDA3; FP3214
Synonyms
PSRC1; PSRC1 cDNA Clone; PSRC1 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggatttggaggaagatgtaaggtttattgtggatgagaccttggactttggggggctgtcaccatctgacagccgtgaggaggaagacataacagtgttggtgactccagagaaaccacttcgacggggcctctcccaccgaagtgacccaaatgcagtggcacctgccccccagggtgtgaggctcagcctaggccccctcagtccagagaagctggaggagatcctcgatgaggccaaccggctggccgctcagctggagcagtgtgccctgcaggatcgggagagcgcaggcgagggcctggggcctcgccgagtgaagcccagtcctcggcgggagacctttgtgctgaaggatagtcctgtccgagacctgctgcccactgtgaactctttgacgcggagcaccccctccccaagcagcctgacgcctcgactccggagtaatgataggaaggggtcagtcagggctctccgggctacatctggaaagaggccctccaacatgaagagggagtcacccacttgcaatctgttccctgcatccaaaagcccagcatcttctcctcttacccgatcgactcccccagtccgggggagagccgggcccagtgggagagcagcagccagtgaggagaccagagcagccaagttgcgggtgagtgggagtggggagtttgtgggattgaccctgaaatttctccacccctctccaccaggcccacccacccccatcagatccgtcctggccccacagccttctaccagcaactctcaacgcctgccccggccgcagggagcagctgctaaatcttccagtcaactgcccattccctcggccatccccaggcctgccagccgaatgccactcaccagccggagtgtgccacctggcagaggtgccctacctccggattctctgtcaactcgaaaagggcttccaagaccaagcactgcaggacacagagtgcgggaaagtggacacaaggttcctgtttcccagcgactaaatcttcctgtcatgggtgccactcgcagcaatctgcagccccccaggaaagtggcagtcccaggacctaccaggtaa
Sequence Length
1092
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,981 Da
NCBI Official Full Name
Homo sapiens proline/serine-rich coiled-coil 1, mRNA
NCBI Official Synonym Full Names
proline and serine rich coiled-coil 1
NCBI Official Symbol
PSRC1
NCBI Official Synonym Symbols
DDA3; FP3214
NCBI Protein Information
proline/serine-rich coiled-coil protein 1
UniProt Protein Name
Proline/serine-rich coiled-coil protein 1
UniProt Gene Name
PSRC1
UniProt Synonym Gene Names
DDA3
UniProt Entry Name
PSRC1_HUMAN

NCBI Description

This gene encodes a proline-rich protein that is a target for regulation by the tumor suppressor protein p53. The encoded protein plays an important role in mitosis by recruiting and regulating microtubule depolymerases that destabalize microtubules. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Apr 2014]

Uniprot Description

PSRC1: Required for normal progression through mitosis. Required for normal congress of chromosomes at the metaphase plate, and for normal rate of chromosomal segregation during anaphase. Plays a role in the regulation of mitotic spindle dynamics. Increases the rate of turnover of microtubules on metaphase spindles, and contributes to the generation of normal tension across sister kinetochores. Recruits KIF2A to the mitotic spindle and spindle poles. May participate in p53/TP53-regulated growth suppression. Belongs to the PSRC1 family. 4 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 1p13.3

Cellular Component: cytoplasm; cytosol; microtubule cytoskeleton; midbody; spindle; spindle microtubule; spindle pole

Molecular Function: microtubule binding; protein binding

Biological Process: microtubule bundle formation; mitotic metaphase plate congression; negative regulation of cell growth; positive regulation of cyclin-dependent protein kinase activity; positive regulation of microtubule polymerization; positive regulation of transcription, DNA-dependent

Research Articles on PSRC1

Similar Products

Product Notes

The PSRC1 psrc1 (Catalog #AAA1271542) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggatt tggaggaaga tgtaaggttt attgtggatg agaccttgga ctttgggggg ctgtcaccat ctgacagccg tgaggaggaa gacataacag tgttggtgac tccagagaaa ccacttcgac ggggcctctc ccaccgaagt gacccaaatg cagtggcacc tgccccccag ggtgtgaggc tcagcctagg ccccctcagt ccagagaagc tggaggagat cctcgatgag gccaaccggc tggccgctca gctggagcag tgtgccctgc aggatcggga gagcgcaggc gagggcctgg ggcctcgccg agtgaagccc agtcctcggc gggagacctt tgtgctgaag gatagtcctg tccgagacct gctgcccact gtgaactctt tgacgcggag caccccctcc ccaagcagcc tgacgcctcg actccggagt aatgatagga aggggtcagt cagggctctc cgggctacat ctggaaagag gccctccaac atgaagaggg agtcacccac ttgcaatctg ttccctgcat ccaaaagccc agcatcttct cctcttaccc gatcgactcc cccagtccgg gggagagccg ggcccagtgg gagagcagca gccagtgagg agaccagagc agccaagttg cgggtgagtg ggagtgggga gtttgtggga ttgaccctga aatttctcca cccctctcca ccaggcccac ccacccccat cagatccgtc ctggccccac agccttctac cagcaactct caacgcctgc cccggccgca gggagcagct gctaaatctt ccagtcaact gcccattccc tcggccatcc ccaggcctgc cagccgaatg ccactcacca gccggagtgt gccacctggc agaggtgccc tacctccgga ttctctgtca actcgaaaag ggcttccaag accaagcact gcaggacaca gagtgcggga aagtggacac aaggttcctg tttcccagcg actaaatctt cctgtcatgg gtgccactcg cagcaatctg cagcccccca ggaaagtggc agtcccagga cctaccaggt aa. It is sometimes possible for the material contained within the vial of "PSRC1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.