Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSMD12 cdna clone

PSMD12 cDNA Clone

Synonyms
PSMD12; PSMD12 cDNA Clone; PSMD12 cdna clone
Ordering
For Research Use Only!
Sequence
atggtatcgacatcccgtatcttagttgcagtagtgaagatgtgctatgaggctaaagaatgggatttacttaatgaaaatattatgcttttgtccaaaaggcggagtcagttaaaacaagctgttgccaaaatggttcaacagtgctgtacttatgttgaggaaatcacagaccttcctatcaaacttcgattaattgatactctacgaatggttaccgaaggcaagatttatgttgaaattgagcgtgcgcgactgactaaaacattagcaactataaaagaacaaaatggtgatgtgaaagaggcagcctccattttacaggagttacaggtggaaacctacgggtcaatggaaaagaaagagcgagtggaatttattttggagcaaatgaggctctgcctagctgtgaaggattacattcgaacacaaatcatcagcaagaaaattaacaccaaatttttccaggaagaaaatacagagaaattaaagttgaagtactataatttaatgattcagctggatcaacatgagggatcctatttgtctatttgtaagcactacagagcaatatatgatactccctgtatacaggcagaaagtgaaaaatggcagcaggctctgaagagtgttgtactctatgttatcctggctccttttgacaatgaacagtcagatttggttcaccgaataagtggtgacaagaagttagaagaaattcccaaatacaaggatcttttaaagctttttaccacaatggagttgatgcgttggtccacacttgttgaggactatggaatggaattaagaaaaggttcccttgagagtcctgcaacggatgtttttggttctacagaggaaggtgaaaaaaggtggaaagacttgaagaacagagttgttgaacataatattagaataatggccaagtattatactcggataacaatgaaaaggatggcacagcttctggatctatctgttgatgagtccgaagcctttctctcaaatctagtagttaacaagaccatctttgctaaagtagacagattagcaggaattatcaacttccagagacccaaggatccaaataatttattaaatgactggtctcagaaactgaactcattaatgtctctggttaacaaaactacgcatctcatagccaaagaggagatgatacataatctacaataa
Sequence Length
1194
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
50,579 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) 26S subunit, non-ATPase, 12, mRNA
UniProt Protein Name
26S proteasome non-ATPase regulatory subunit 12
UniProt Gene Name
PSMD12
UniProt Entry Name
PSD12_HUMAN

Uniprot Description

PSMD12: Acts as a regulatory subunit of the 26S proteasome which is involved in the ATP-dependent degradation of ubiquitinated proteins. Belongs to the proteasome subunit p55 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Protease; Proteasome complex

Chromosomal Location of Human Ortholog: 17q24.2

Cellular Component: cytoplasm; cytosol; membrane; nucleoplasm; proteasome complex; proteasome regulatory particle

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; MAPKKK cascade; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; regulation of amino acid metabolic process; regulation of mRNA stability; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; Wnt receptor signaling pathway, planar cell polarity pathway

Similar Products

Product Notes

The PSMD12 psmd12 (Catalog #AAA1269274) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtatcga catcccgtat cttagttgca gtagtgaaga tgtgctatga ggctaaagaa tgggatttac ttaatgaaaa tattatgctt ttgtccaaaa ggcggagtca gttaaaacaa gctgttgcca aaatggttca acagtgctgt acttatgttg aggaaatcac agaccttcct atcaaacttc gattaattga tactctacga atggttaccg aaggcaagat ttatgttgaa attgagcgtg cgcgactgac taaaacatta gcaactataa aagaacaaaa tggtgatgtg aaagaggcag cctccatttt acaggagtta caggtggaaa cctacgggtc aatggaaaag aaagagcgag tggaatttat tttggagcaa atgaggctct gcctagctgt gaaggattac attcgaacac aaatcatcag caagaaaatt aacaccaaat ttttccagga agaaaataca gagaaattaa agttgaagta ctataattta atgattcagc tggatcaaca tgagggatcc tatttgtcta tttgtaagca ctacagagca atatatgata ctccctgtat acaggcagaa agtgaaaaat ggcagcaggc tctgaagagt gttgtactct atgttatcct ggctcctttt gacaatgaac agtcagattt ggttcaccga ataagtggtg acaagaagtt agaagaaatt cccaaataca aggatctttt aaagcttttt accacaatgg agttgatgcg ttggtccaca cttgttgagg actatggaat ggaattaaga aaaggttccc ttgagagtcc tgcaacggat gtttttggtt ctacagagga aggtgaaaaa aggtggaaag acttgaagaa cagagttgtt gaacataata ttagaataat ggccaagtat tatactcgga taacaatgaa aaggatggca cagcttctgg atctatctgt tgatgagtcc gaagcctttc tctcaaatct agtagttaac aagaccatct ttgctaaagt agacagatta gcaggaatta tcaacttcca gagacccaag gatccaaata atttattaaa tgactggtct cagaaactga actcattaat gtctctggtt aacaaaacta cgcatctcat agccaaagag gagatgatac ataatctaca ataa. It is sometimes possible for the material contained within the vial of "PSMD12, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.