Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSMC4 cdna clone

PSMC4 cDNA Clone

Gene Names
PSMC4; S6; RPT3; TBP7; TBP-7; MIP224
Synonyms
PSMC4; PSMC4 cDNA Clone; PSMC4 cdna clone
Ordering
For Research Use Only!
Sequence
atggaggagataggcatcttggtggagaaggctcaggatgagatcccagcactgtccgtgtcccggccccagaccggcctgtccttcctgggccctgagcctgaggacctggaggacctgtacagccgctacaagaagctgcagcaagagctggagttcctggaggtgcaggaggaatacatcaaagatgagcaaaagaacctgaaaaaggaatttctccatgcccaggaggaggtgaagcgaatccaaagcatcccgctggtcatcggacaatttctggaggctgtggatcagaatacagccatcgtgggctctaccacaggctccaactattatgtgcgcatcctgagcaccatcgatcgggagctgctcaagcccaacgcctcagtggccctccacaagcacagcaatgcactggtggacgtgctgccccccgaagccgacagcagcatcatgatgctcacctcagaccagaagccagatgtgatgtacgcggacatcggaggcatggacatccagaagcaggaggtgcgggaggccgtggagctcccgctcacgcatttcgagctctacaagcagatcggcatcgatcccccccgaggcgtcctcatgtatggcccacctggctgtgggaagaccatgttggcaaaggcggtggcacatcacacaacagctgcattcatccgggtcgtgggctcggagtttgtacagaagtatctgggtgagggcccccgcatggtccgggatgtgttccgcctggccaaggagaatgcacctgccatcatcttcatagacgagattgatgccatcgccaccaagagattcgatgctcagacaggggccgacagggaggttcagaggatcctgctggagctgctgaatcagatggatggatttgatcagaatgtcaatgtcaaggtaatcatggccacaaacagagcagacaccctggatccggccctgctacggccaggacggctggaccgtaaaattgaatttccacttcctgaccgccgccagaagagattgattttctccactatcactagcaagatgaacctctctgaggaggttgacttggaagactatgtggcccggccagataagatttcaggagctgatattaactccatctgtcaggagagtggaatgttggctgtccgtgaaaaccgctacattgtcctggccaaggacttcgagaaagcatacaagactgtcatcaagaaggacgagcaggagcatgagttttacaagtga
Sequence Length
1257
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
43,508 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) 26S subunit, ATPase, 4, mRNA
NCBI Official Synonym Full Names
proteasome 26S subunit, ATPase 4
NCBI Official Symbol
PSMC4
NCBI Official Synonym Symbols
S6; RPT3; TBP7; TBP-7; MIP224
NCBI Protein Information
26S protease regulatory subunit 6B
UniProt Protein Name
26S protease regulatory subunit 6B
Protein Family
UniProt Gene Name
PSMC4
UniProt Synonym Gene Names
MIP224; TBP7; TBP-7
UniProt Entry Name
PRS6B_HUMAN

NCBI Description

The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 20S core is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. This gene encodes a member of the triple-A family of ATPases that is a component of the 19S regulatory subunit and plays a role in 26S proteasome assembly. The encoded protein interacts with gankyrin, a liver oncoprotein, and may also play a role in Parkinson's disease through interactions with synphilin-1. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jul 2012]

Uniprot Description

RPT3: an ATPase subunit of the 26S proteasome. A member of the triple-A family of ATPases which have a chaperone-like activity. Interacts with an orphan member of the nuclear hormone receptor superfamily highly expressed in liver, and with gankyrin, a liver oncoprotein. The 26S proteasome is a multicatalytic proteinase complex with a highly ordered structure composed of 2 complexes, a 20S core and a 19S regulator. The 19S regulator is composed of a base, which contains 6 ATPase subunits and 2 non-ATPase subunits, and a lid, which contains up to 10 non-ATPase subunits. Two splice variant isoforms have been described.

Protein type: Proteasome complex; Nuclear receptor co-regulator; Protease

Chromosomal Location of Human Ortholog: 19q13.11-q13.13

Cellular Component: cytoplasm; cytosol; membrane; nucleoplasm; nucleus; proteasome complex

Molecular Function: ATPase activity; protein binding; TATA-binding protein binding

Biological Process: anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; ER-associated protein catabolic process; MAPKKK cascade; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of transcriptional preinitiation complex assembly; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; proteolysis; regulation of amino acid metabolic process; regulation of mRNA stability; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; Wnt receptor signaling pathway, planar cell polarity pathway

Research Articles on PSMC4

Similar Products

Product Notes

The PSMC4 psmc4 (Catalog #AAA1277680) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggaggaga taggcatctt ggtggagaag gctcaggatg agatcccagc actgtccgtg tcccggcccc agaccggcct gtccttcctg ggccctgagc ctgaggacct ggaggacctg tacagccgct acaagaagct gcagcaagag ctggagttcc tggaggtgca ggaggaatac atcaaagatg agcaaaagaa cctgaaaaag gaatttctcc atgcccagga ggaggtgaag cgaatccaaa gcatcccgct ggtcatcgga caatttctgg aggctgtgga tcagaataca gccatcgtgg gctctaccac aggctccaac tattatgtgc gcatcctgag caccatcgat cgggagctgc tcaagcccaa cgcctcagtg gccctccaca agcacagcaa tgcactggtg gacgtgctgc cccccgaagc cgacagcagc atcatgatgc tcacctcaga ccagaagcca gatgtgatgt acgcggacat cggaggcatg gacatccaga agcaggaggt gcgggaggcc gtggagctcc cgctcacgca tttcgagctc tacaagcaga tcggcatcga tcccccccga ggcgtcctca tgtatggccc acctggctgt gggaagacca tgttggcaaa ggcggtggca catcacacaa cagctgcatt catccgggtc gtgggctcgg agtttgtaca gaagtatctg ggtgagggcc cccgcatggt ccgggatgtg ttccgcctgg ccaaggagaa tgcacctgcc atcatcttca tagacgagat tgatgccatc gccaccaaga gattcgatgc tcagacaggg gccgacaggg aggttcagag gatcctgctg gagctgctga atcagatgga tggatttgat cagaatgtca atgtcaaggt aatcatggcc acaaacagag cagacaccct ggatccggcc ctgctacggc caggacggct ggaccgtaaa attgaatttc cacttcctga ccgccgccag aagagattga ttttctccac tatcactagc aagatgaacc tctctgagga ggttgacttg gaagactatg tggcccggcc agataagatt tcaggagctg atattaactc catctgtcag gagagtggaa tgttggctgt ccgtgaaaac cgctacattg tcctggccaa ggacttcgag aaagcataca agactgtcat caagaaggac gagcaggagc atgagtttta caagtga. It is sometimes possible for the material contained within the vial of "PSMC4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.