Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PSMA6 cdna clone

PSMA6 cDNA Clone

Gene Names
PSMA6; IOTA; p27K; PROS27
Synonyms
PSMA6; PSMA6 cDNA Clone; PSMA6 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcccgtggttccagcgccggttttgaccgccacattaccattttttcacccgagggtcggctctaccaagtagaatatgcttttaaggctattaaccagggtggccttacatcagtagctgtcagagggaaagactgtgcagtaattgtcacacagaagaaagtacctgacaaattattggattccagcacagtgactcacttattcaagataactgaaaacattggttgtgtgatgaccggaatgacagctgacagcagatcccaggtacagagggcacgctatgaggcagctaactggaaatacaagtatggctatgagattcctgtggacatgctgtgtaaaagaattgccgatatttctcaggtctacacacagaatgctgaaatgaggcctcttggttgttgtatgattttaattggtatagatgaagagcaaggccctcaggtatataagtgtgatcctgcaggttactactgtgggtttaaagccactgcagcgggagttaaacaaactgagtcaaccagcttccttgaaaaaaaagtgaagaagaaatttgattggacatttgaacagacagtggaaactgcaattacatgcctgtctactgttctatcaattgatttcaaaccttcagaaatagaagttggagtagtgacagttgaaaatcctaaattcaggattcttacagaagcagagattgatgctcaccttgttgctctagcagagagagactaa
Sequence Length
741
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,816 Da
NCBI Official Full Name
Homo sapiens proteasome (prosome, macropain) subunit, alpha type, 6, mRNA
NCBI Official Synonym Full Names
proteasome subunit alpha 6
NCBI Official Symbol
PSMA6
NCBI Official Synonym Symbols
IOTA; p27K; PROS27
NCBI Protein Information
proteasome subunit alpha type-6
UniProt Protein Name
Proteasome subunit alpha type-6
Protein Family
UniProt Gene Name
PSMA6
UniProt Synonym Gene Names
PROS27; PROS-27; p27K
UniProt Entry Name
PSA6_HUMAN

NCBI Description

The proteasome is a multicatalytic proteinase complex with a highly ordered ring-shaped 20S core structure. The core structure is composed of 4 rings of 28 non-identical subunits; 2 rings are composed of 7 alpha subunits and 2 rings are composed of 7 beta subunits. Proteasomes are distributed throughout eukaryotic cells at a high concentration and cleave peptides in an ATP/ubiquitin-dependent process in a non-lysosomal pathway. An essential function of a modified proteasome, the immunoproteasome, is the processing of class I MHC peptides. This gene encodes a member of the peptidase T1A family, that is a 20S core alpha subunit. Multiple transcript variants encoding several different isoforms have been found for this gene. A pseudogene has been identified on the Y chromosome. [provided by RefSeq, Aug 2013]

Uniprot Description

PSMA6: The proteasome is a multicatalytic proteinase complex which is characterized by its ability to cleave peptides with Arg, Phe, Tyr, Leu, and Glu adjacent to the leaving group at neutral or slightly basic pH. The proteasome has an ATP-dependent proteolytic activity. The 26S proteasome consists of a 20S proteasome core and two 19S regulatory subunits. The 20S proteasome core is composed of 28 subunits that are arranged in four stacked rings, resulting in a barrel-shaped structure. The two end rings are each formed by seven alpha subunits, and the two central rings are each formed by seven beta subunits. The catalytic chamber with the active sites is on the inside of the barrel. Belongs to the peptidase T1A family.

Protein type: EC 3.4.25.1; Protease; Proteasome complex

Chromosomal Location of Human Ortholog: 14q13

Cellular Component: cytoplasm; cytosol; myofibril; nuclear matrix; nucleoplasm; nucleus; polysome; proteasome complex; proteasome core complex; sarcomere

Molecular Function: NF-kappaB binding; protein binding; RNA binding

Biological Process: activation of NF-kappaB transcription factor; anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process; antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent; MAPKKK cascade; negative regulation of ubiquitin-protein ligase activity during mitotic cell cycle; positive regulation of ubiquitin-protein ligase activity during mitotic cell cycle; proteasomal ubiquitin-dependent protein catabolic process; protein polyubiquitination; proteolysis involved in cellular protein catabolic process; regulation of amino acid metabolic process; regulation of inflammatory response; regulation of mRNA stability; stimulatory C-type lectin receptor signaling pathway; T cell receptor signaling pathway; tumor necrosis factor-mediated signaling pathway; Wnt receptor signaling pathway, planar cell polarity pathway

Disease: Myocardial Infarction, Susceptibility To

Research Articles on PSMA6

Similar Products

Product Notes

The PSMA6 psma6 (Catalog #AAA1273212) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcccgtg gttccagcgc cggttttgac cgccacatta ccattttttc acccgagggt cggctctacc aagtagaata tgcttttaag gctattaacc agggtggcct tacatcagta gctgtcagag ggaaagactg tgcagtaatt gtcacacaga agaaagtacc tgacaaatta ttggattcca gcacagtgac tcacttattc aagataactg aaaacattgg ttgtgtgatg accggaatga cagctgacag cagatcccag gtacagaggg cacgctatga ggcagctaac tggaaataca agtatggcta tgagattcct gtggacatgc tgtgtaaaag aattgccgat atttctcagg tctacacaca gaatgctgaa atgaggcctc ttggttgttg tatgatttta attggtatag atgaagagca aggccctcag gtatataagt gtgatcctgc aggttactac tgtgggttta aagccactgc agcgggagtt aaacaaactg agtcaaccag cttccttgaa aaaaaagtga agaagaaatt tgattggaca tttgaacaga cagtggaaac tgcaattaca tgcctgtcta ctgttctatc aattgatttc aaaccttcag aaatagaagt tggagtagtg acagttgaaa atcctaaatt caggattctt acagaagcag agattgatgc tcaccttgtt gctctagcag agagagacta a. It is sometimes possible for the material contained within the vial of "PSMA6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.