Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRH1 cdna clone

PRH1 cDNA Clone

Gene Names
PRH1; PA; Db-s; PRH2; PIF-S; Pr1/Pr2
Synonyms
PRH1; PRH1 cDNA Clone; PRH1 cdna clone
Ordering
For Research Use Only!
Sequence
ATGCTTCTGATTCTGCTGTCAGTGGCCCTGCTGGCCTTCAGCTCAGCTCAGGATTTAAATGAAGATGTCAGCCAGGAAGATGTTCCCCTCGTAATATCAGATGGAGGAGACTCTGAGCAGTTCATAGATGAGGAGCGTCAGGGACCACCTTTGGGAGGACAGCAATCTCAACCCTCTGCTGGTGATGGGAACCAGGATGATGGCCCTCAGCAGGGACCACCCCAACAAGGAGGCCAGCAGCAACAAGGTCCACCACCTCCTCAGGGAAAGCCACAAGGACCACCCCAACAGGGAGGCCATCCCCCTCCTCCTCAAGGAAGGCCACAAGGACCACCCCAACAGGGAGGCCATCCCCGTCCTCCTCGAGGAAGGCCACAAGGACCACCCCAACAGGGAGGCCATCAGCAAGGTCCTCCCCCACCTCCTCCTGGAAAGCCCCAGGGACCACCTCCCCAAGGGGGCCGCCCACAAGGACCTCCACAGGGGCAGTCTCCTCAGTAA
Sequence Length
501
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,016 Da
NCBI Official Full Name
Homo sapiens proline-rich protein HaeIII subfamily 1, mRNA
NCBI Official Synonym Full Names
proline rich protein HaeIII subfamily 1
NCBI Official Symbol
PRH1
NCBI Official Synonym Symbols
PA; Db-s; PRH2; PIF-S; Pr1/Pr2
NCBI Protein Information
salivary acidic proline-rich phosphoprotein 1/2
UniProt Protein Name
Salivary acidic proline-rich phosphoprotein 1/2
UniProt Gene Name
PRH1
UniProt Synonym Gene Names
Pa; PIF-S
UniProt Entry Name
PRPC_HUMAN

NCBI Description

This gene encodes a member of the heterogeneous family of proline-rich salivary glycoproteins. The encoded preproprotein undergoes proteolytic processing to generate one or more mature isoforms before secretion from the parotid and submandibular/sublingual glands. Multiple distinct alleles of this locus including the parotid isoelectric-focusing variant slow (PIF-s), the parotid acidic protein (Pa), and the double band slow (Db-s) isoforms have been characterized. The reference genome encodes the Db-s allele. Certain alleles of this gene are associated with susceptibility to dental caries. This gene is located in a cluster of closely related salivary proline-rich proteins on chromosome 12. Co-transcription of this gene with adjacent genes has been observed. Alternate splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Oct 2015]

Uniprot Description

PRH: PRP's act as highly potent inhibitors of crystal growth of calcium phosphates. They provide a protective and reparative environment for dental enamel which is important for the integrity of the teeth.

Protein type: Inhibitor

Chromosomal Location of Human Ortholog: 12p13.2

Cellular Component: extracellular space

Molecular Function: protein binding

Research Articles on PRH1

Similar Products

Product Notes

The PRH1 prh1 (Catalog #AAA1266285) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: ATGCTTCTGA TTCTGCTGTC AGTGGCCCTG CTGGCCTTCA GCTCAGCTCA GGATTTAAAT GAAGATGTCA GCCAGGAAGA TGTTCCCCTC GTAATATCAG ATGGAGGAGA CTCTGAGCAG TTCATAGATG AGGAGCGTCA GGGACCACCT TTGGGAGGAC AGCAATCTCA ACCCTCTGCT GGTGATGGGA ACCAGGATGA TGGCCCTCAG CAGGGACCAC CCCAACAAGG AGGCCAGCAG CAACAAGGTC CACCACCTCC TCAGGGAAAG CCACAAGGAC CACCCCAACA GGGAGGCCAT CCCCCTCCTC CTCAAGGAAG GCCACAAGGA CCACCCCAAC AGGGAGGCCA TCCCCGTCCT CCTCGAGGAA GGCCACAAGG ACCACCCCAA CAGGGAGGCC ATCAGCAAGG TCCTCCCCCA CCTCCTCCTG GAAAGCCCCA GGGACCACCT CCCCAAGGGG GCCGCCCACA AGGACCTCCA CAGGGGCAGT CTCCTCAGTA A. It is sometimes possible for the material contained within the vial of "PRH1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.