Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRDM5 cdna clone

PRDM5 cDNA Clone

Gene Names
PRDM5; BCS2; PFM2
Synonyms
PRDM5; PRDM5 cDNA Clone; PRDM5 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgggcatgtacgtgccggacaggttctccctgaagtcctcccgggttcaggacggcatggggctctacacggcccgcagagtgcgaaagggtgaaaagttcggaccctttgctggagagaagagaatgcctgaagacttggatgaaaatatggattacaggttgatgtgggaggttcgtgggagtaagggagaagttttgtacattttggatgctaccaacccacggcactccaactggcttcgcttcgttcatgaggcaccatctcaggagcagaagaacttggctgccattcaagacaagaatttgggacccgccgaatggcgaggctaa
Sequence Length
336
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
58,124 Da
NCBI Official Full Name
Homo sapiens PR domain containing 5, mRNA
NCBI Official Synonym Full Names
PR/SET domain 5
NCBI Official Symbol
PRDM5
NCBI Official Synonym Symbols
BCS2; PFM2
NCBI Protein Information
PR domain zinc finger protein 5
UniProt Protein Name
PR domain zinc finger protein 5
UniProt Gene Name
PRDM5
UniProt Synonym Gene Names
PFM2
UniProt Entry Name
PRDM5_HUMAN

NCBI Description

The protein encoded by this gene is a transcription factor of the PR-domain protein family. It contains a PR-domain and multiple zinc finger motifs. Transcription factors of the PR-domain family are known to be involved in cell differentiation and tumorigenesis. [provided by RefSeq, Jul 2008]

Uniprot Description

PRDM5: Sequence-specific DNA-binding transcription factor. Represses transcription at least in part by recruitment of the histone methyltransferase EHMT2/G9A and histone deacetylases such as HDAC1. Regulates hematopoiesis-associated protein-coding and microRNA (miRNA) genes. May regulate the expression of proteins involved in extracellular matrix development and maintenance, including fibrillar collagens, such as COL4A1 and COL11A1, connective tissue components, such as HAPLN1, and molecules regulating cell migration and adhesion, including EDIL3 and TGFB2. May caused G2/M arrest and apoptosis in cancer cells. Defects in PRDM5 are the cause of Brittle cornea syndrome type 2 (BCS2). A disorder characterized by extreme corneal thinning resulting in corneal rupture after minor trauma, blue sclerae, keratoconus or keratoglobus, hyperelasticity of the skin, and hypermobile joints. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Methyltransferase, protein lysine, predicted; DNA-binding; Transcription factor; C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 4q25-q26

Cellular Component: nucleus

Molecular Function: protein binding; sequence-specific DNA binding

Biological Process: histone deacetylation; histone H3-K9 methylation; mitotic cell cycle; negative regulation of transcription from RNA polymerase II promoter; negative regulation of transcription, DNA-dependent

Disease: Brittle Cornea Syndrome 2

Research Articles on PRDM5

Similar Products

Product Notes

The PRDM5 prdm5 (Catalog #AAA1266458) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgggca tgtacgtgcc ggacaggttc tccctgaagt cctcccgggt tcaggacggc atggggctct acacggcccg cagagtgcga aagggtgaaa agttcggacc ctttgctgga gagaagagaa tgcctgaaga cttggatgaa aatatggatt acaggttgat gtgggaggtt cgtgggagta agggagaagt tttgtacatt ttggatgcta ccaacccacg gcactccaac tggcttcgct tcgttcatga ggcaccatct caggagcaga agaacttggc tgccattcaa gacaagaatt tgggacccgc cgaatggcga ggctaa. It is sometimes possible for the material contained within the vial of "PRDM5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.